ID: 910035851

View in Genome Browser
Species Human (GRCh38)
Location 1:82787354-82787376
Sequence ACAGCACAAAAGGGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910035845_910035851 5 Left 910035845 1:82787326-82787348 CCCTGTTCTGAAAGGCTGCTCGG No data
Right 910035851 1:82787354-82787376 ACAGCACAAAAGGGGAAAGCTGG No data
910035847_910035851 4 Left 910035847 1:82787327-82787349 CCTGTTCTGAAAGGCTGCTCGGA No data
Right 910035851 1:82787354-82787376 ACAGCACAAAAGGGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910035851 Original CRISPR ACAGCACAAAAGGGGAAAGC TGG Intergenic
No off target data available for this crispr