ID: 910045811

View in Genome Browser
Species Human (GRCh38)
Location 1:82913953-82913975
Sequence TTGATTCTTACATGGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910045811_910045816 25 Left 910045811 1:82913953-82913975 CCTGCATTCCATGTAAGAATCAA No data
Right 910045816 1:82914001-82914023 CAAACAAGTGGCCTCCCAAATGG No data
910045811_910045813 13 Left 910045811 1:82913953-82913975 CCTGCATTCCATGTAAGAATCAA No data
Right 910045813 1:82913989-82914011 AGAAACCAGAGCCAAACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910045811 Original CRISPR TTGATTCTTACATGGAATGC AGG (reversed) Intergenic
No off target data available for this crispr