ID: 910048663

View in Genome Browser
Species Human (GRCh38)
Location 1:82950565-82950587
Sequence TTGGACGTATAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910048659_910048663 17 Left 910048659 1:82950525-82950547 CCCAAATTAGAGACTAAAATAGA No data
Right 910048663 1:82950565-82950587 TTGGACGTATAGATGGAGTAAGG No data
910048660_910048663 16 Left 910048660 1:82950526-82950548 CCAAATTAGAGACTAAAATAGAA No data
Right 910048663 1:82950565-82950587 TTGGACGTATAGATGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910048663 Original CRISPR TTGGACGTATAGATGGAGTA AGG Intergenic
No off target data available for this crispr