ID: 910049072

View in Genome Browser
Species Human (GRCh38)
Location 1:82955774-82955796
Sequence CAGAGCAAAGAGCAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910049072_910049076 4 Left 910049072 1:82955774-82955796 CCGTCCTCCTGCTCTTTGCTCTG No data
Right 910049076 1:82955801-82955823 AAAGATCCACCTATGACCTCGGG 0: 158
1: 377
2: 219
3: 116
4: 140
910049072_910049080 27 Left 910049072 1:82955774-82955796 CCGTCCTCCTGCTCTTTGCTCTG No data
Right 910049080 1:82955824-82955846 TCCTCAGACCCGCCAGCCCAAGG No data
910049072_910049075 3 Left 910049072 1:82955774-82955796 CCGTCCTCCTGCTCTTTGCTCTG No data
Right 910049075 1:82955800-82955822 AAAAGATCCACCTATGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910049072 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr