ID: 910051719 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:82982085-82982107 |
| Sequence | CTGTAGCACTGCTGGGAAAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910051715_910051719 | -1 | Left | 910051715 | 1:82982063-82982085 | CCCAAAAGAACATGGAGGCTTTC | No data | ||
| Right | 910051719 | 1:82982085-82982107 | CTGTAGCACTGCTGGGAAATAGG | No data | ||||
| 910051716_910051719 | -2 | Left | 910051716 | 1:82982064-82982086 | CCAAAAGAACATGGAGGCTTTCT | No data | ||
| Right | 910051719 | 1:82982085-82982107 | CTGTAGCACTGCTGGGAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910051719 | Original CRISPR | CTGTAGCACTGCTGGGAAAT AGG | Intergenic | ||
| No off target data available for this crispr | |||||