ID: 910051719

View in Genome Browser
Species Human (GRCh38)
Location 1:82982085-82982107
Sequence CTGTAGCACTGCTGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910051715_910051719 -1 Left 910051715 1:82982063-82982085 CCCAAAAGAACATGGAGGCTTTC No data
Right 910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG No data
910051716_910051719 -2 Left 910051716 1:82982064-82982086 CCAAAAGAACATGGAGGCTTTCT No data
Right 910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910051719 Original CRISPR CTGTAGCACTGCTGGGAAAT AGG Intergenic
No off target data available for this crispr