ID: 910054707

View in Genome Browser
Species Human (GRCh38)
Location 1:83018889-83018911
Sequence ATGTATACACATATATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910054707_910054709 -5 Left 910054707 1:83018889-83018911 CCCTGCTATATATGTGTATACAT No data
Right 910054709 1:83018907-83018929 TACATAGCTACATATATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910054707 Original CRISPR ATGTATACACATATATAGCA GGG (reversed) Intergenic
No off target data available for this crispr