ID: 910054709

View in Genome Browser
Species Human (GRCh38)
Location 1:83018907-83018929
Sequence TACATAGCTACATATATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910054708_910054709 -6 Left 910054708 1:83018890-83018912 CCTGCTATATATGTGTATACATA No data
Right 910054709 1:83018907-83018929 TACATAGCTACATATATTTTAGG No data
910054707_910054709 -5 Left 910054707 1:83018889-83018911 CCCTGCTATATATGTGTATACAT No data
Right 910054709 1:83018907-83018929 TACATAGCTACATATATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910054709 Original CRISPR TACATAGCTACATATATTTT AGG Intergenic
No off target data available for this crispr