ID: 910057035

View in Genome Browser
Species Human (GRCh38)
Location 1:83045591-83045613
Sequence ATGGAAACACAATGGCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910057032_910057035 1 Left 910057032 1:83045567-83045589 CCTCTTGTTTCTCTGTTGTTTGT No data
Right 910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG No data
910057031_910057035 2 Left 910057031 1:83045566-83045588 CCCTCTTGTTTCTCTGTTGTTTG No data
Right 910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG No data
910057030_910057035 3 Left 910057030 1:83045565-83045587 CCCCTCTTGTTTCTCTGTTGTTT No data
Right 910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910057035 Original CRISPR ATGGAAACACAATGGCATCT AGG Intergenic
No off target data available for this crispr