ID: 910061616

View in Genome Browser
Species Human (GRCh38)
Location 1:83100357-83100379
Sequence GGGAATAAATGCTCTTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061616_910061618 -8 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061618 1:83100372-83100394 TTATTCCCATTTTACAGATAAGG 0: 29
1: 370
2: 1962
3: 5063
4: 10316
910061616_910061624 28 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061624 1:83100408-83100430 GAGGCTATATGATTGCATCCAGG No data
910061616_910061623 9 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061623 1:83100389-83100411 ATAAGGAAGTGGTGAGGAAGAGG No data
910061616_910061621 -2 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061621 1:83100378-83100400 CCATTTTACAGATAAGGAAGTGG No data
910061616_910061622 3 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061622 1:83100383-83100405 TTACAGATAAGGAAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061616 Original CRISPR GGGAATAAATGCTCTTACGT GGG (reversed) Intergenic
No off target data available for this crispr