ID: 910061617

View in Genome Browser
Species Human (GRCh38)
Location 1:83100358-83100380
Sequence TGGGAATAAATGCTCTTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061617_910061622 2 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061622 1:83100383-83100405 TTACAGATAAGGAAGTGGTGAGG No data
910061617_910061623 8 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061623 1:83100389-83100411 ATAAGGAAGTGGTGAGGAAGAGG No data
910061617_910061624 27 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061624 1:83100408-83100430 GAGGCTATATGATTGCATCCAGG No data
910061617_910061621 -3 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061621 1:83100378-83100400 CCATTTTACAGATAAGGAAGTGG No data
910061617_910061618 -9 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061618 1:83100372-83100394 TTATTCCCATTTTACAGATAAGG 0: 29
1: 370
2: 1962
3: 5063
4: 10316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061617 Original CRISPR TGGGAATAAATGCTCTTACG TGG (reversed) Intergenic
No off target data available for this crispr