ID: 910061618

View in Genome Browser
Species Human (GRCh38)
Location 1:83100372-83100394
Sequence TTATTCCCATTTTACAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17740
Summary {0: 29, 1: 370, 2: 1962, 3: 5063, 4: 10316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061616_910061618 -8 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061618 1:83100372-83100394 TTATTCCCATTTTACAGATAAGG 0: 29
1: 370
2: 1962
3: 5063
4: 10316
910061617_910061618 -9 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061618 1:83100372-83100394 TTATTCCCATTTTACAGATAAGG 0: 29
1: 370
2: 1962
3: 5063
4: 10316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061618 Original CRISPR TTATTCCCATTTTACAGATA AGG Intergenic
Too many off-targets to display for this crispr