ID: 910061619

View in Genome Browser
Species Human (GRCh38)
Location 1:83100377-83100399
Sequence CACTTCCTTATCTGTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8910
Summary {0: 3, 1: 39, 2: 373, 3: 2008, 4: 6487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061619_910061625 15 Left 910061619 1:83100377-83100399 CCCATTTTACAGATAAGGAAGTG 0: 3
1: 39
2: 373
3: 2008
4: 6487
Right 910061625 1:83100415-83100437 TATGATTGCATCCAGGTCTTAGG No data
910061619_910061627 28 Left 910061619 1:83100377-83100399 CCCATTTTACAGATAAGGAAGTG 0: 3
1: 39
2: 373
3: 2008
4: 6487
Right 910061627 1:83100428-83100450 AGGTCTTAGGTCTTAATCTCAGG No data
910061619_910061624 8 Left 910061619 1:83100377-83100399 CCCATTTTACAGATAAGGAAGTG 0: 3
1: 39
2: 373
3: 2008
4: 6487
Right 910061624 1:83100408-83100430 GAGGCTATATGATTGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061619 Original CRISPR CACTTCCTTATCTGTAAAAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr