ID: 910061620

View in Genome Browser
Species Human (GRCh38)
Location 1:83100378-83100400
Sequence CCACTTCCTTATCTGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061620_910061627 27 Left 910061620 1:83100378-83100400 CCATTTTACAGATAAGGAAGTGG No data
Right 910061627 1:83100428-83100450 AGGTCTTAGGTCTTAATCTCAGG No data
910061620_910061624 7 Left 910061620 1:83100378-83100400 CCATTTTACAGATAAGGAAGTGG No data
Right 910061624 1:83100408-83100430 GAGGCTATATGATTGCATCCAGG No data
910061620_910061625 14 Left 910061620 1:83100378-83100400 CCATTTTACAGATAAGGAAGTGG No data
Right 910061625 1:83100415-83100437 TATGATTGCATCCAGGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061620 Original CRISPR CCACTTCCTTATCTGTAAAA TGG (reversed) Intergenic
No off target data available for this crispr