ID: 910061622

View in Genome Browser
Species Human (GRCh38)
Location 1:83100383-83100405
Sequence TTACAGATAAGGAAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061616_910061622 3 Left 910061616 1:83100357-83100379 CCCACGTAAGAGCATTTATTCCC No data
Right 910061622 1:83100383-83100405 TTACAGATAAGGAAGTGGTGAGG No data
910061617_910061622 2 Left 910061617 1:83100358-83100380 CCACGTAAGAGCATTTATTCCCA No data
Right 910061622 1:83100383-83100405 TTACAGATAAGGAAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061622 Original CRISPR TTACAGATAAGGAAGTGGTG AGG Intergenic
No off target data available for this crispr