ID: 910061625

View in Genome Browser
Species Human (GRCh38)
Location 1:83100415-83100437
Sequence TATGATTGCATCCAGGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910061619_910061625 15 Left 910061619 1:83100377-83100399 CCCATTTTACAGATAAGGAAGTG 0: 3
1: 39
2: 373
3: 2008
4: 6487
Right 910061625 1:83100415-83100437 TATGATTGCATCCAGGTCTTAGG No data
910061620_910061625 14 Left 910061620 1:83100378-83100400 CCATTTTACAGATAAGGAAGTGG No data
Right 910061625 1:83100415-83100437 TATGATTGCATCCAGGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910061625 Original CRISPR TATGATTGCATCCAGGTCTT AGG Intergenic
No off target data available for this crispr