ID: 910062388

View in Genome Browser
Species Human (GRCh38)
Location 1:83109617-83109639
Sequence ATTTCCATCTAGACAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910062388_910062392 21 Left 910062388 1:83109617-83109639 CCTTTACTTGTCTAGATGGAAAT No data
Right 910062392 1:83109661-83109683 CCAAATGCATATGGAAGTCTGGG No data
910062388_910062390 20 Left 910062388 1:83109617-83109639 CCTTTACTTGTCTAGATGGAAAT No data
Right 910062390 1:83109660-83109682 TCCAAATGCATATGGAAGTCTGG No data
910062388_910062389 12 Left 910062388 1:83109617-83109639 CCTTTACTTGTCTAGATGGAAAT No data
Right 910062389 1:83109652-83109674 GTTATATGTCCAAATGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910062388 Original CRISPR ATTTCCATCTAGACAAGTAA AGG (reversed) Intergenic
No off target data available for this crispr