ID: 910065357

View in Genome Browser
Species Human (GRCh38)
Location 1:83144296-83144318
Sequence ACTCACTGACCATTTTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910065345_910065357 28 Left 910065345 1:83144245-83144267 CCCAGGATTGCAAAGGGGTCCAT No data
Right 910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG No data
910065352_910065357 -9 Left 910065352 1:83144282-83144304 CCCCAGGGACCCTCACTCACTGA No data
Right 910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG No data
910065349_910065357 9 Left 910065349 1:83144264-83144286 CCATGGCAGAAGTGTGGTCCCCA No data
Right 910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG No data
910065346_910065357 27 Left 910065346 1:83144246-83144268 CCAGGATTGCAAAGGGGTCCATG No data
Right 910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG No data
910065353_910065357 -10 Left 910065353 1:83144283-83144305 CCCAGGGACCCTCACTCACTGAC No data
Right 910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910065357 Original CRISPR ACTCACTGACCATTTTCCCG AGG Intergenic
No off target data available for this crispr