ID: 910065760

View in Genome Browser
Species Human (GRCh38)
Location 1:83148697-83148719
Sequence CTGGAATTGCAGAGAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910065757_910065760 24 Left 910065757 1:83148650-83148672 CCACAGAATGGGAACACAAGTGA No data
Right 910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910065760 Original CRISPR CTGGAATTGCAGAGAGATCA AGG Intergenic
No off target data available for this crispr