ID: 910066039

View in Genome Browser
Species Human (GRCh38)
Location 1:83151781-83151803
Sequence AACCTCTTGCTAAAGCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910066038_910066039 -2 Left 910066038 1:83151760-83151782 CCTTTGGAGTTTATAGGACTAAA No data
Right 910066039 1:83151781-83151803 AACCTCTTGCTAAAGCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910066039 Original CRISPR AACCTCTTGCTAAAGCCAAC TGG Intergenic
No off target data available for this crispr