ID: 910067850

View in Genome Browser
Species Human (GRCh38)
Location 1:83174790-83174812
Sequence ATTTTCTCCCCTTTTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910067850_910067854 8 Left 910067850 1:83174790-83174812 CCAGTAGGAAAAGGGGAGAAAAT No data
Right 910067854 1:83174821-83174843 AGGAGAGACAAGGAAATTGCTGG No data
910067850_910067853 -2 Left 910067850 1:83174790-83174812 CCAGTAGGAAAAGGGGAGAAAAT No data
Right 910067853 1:83174811-83174833 ATGGTGTTAAAGGAGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910067850 Original CRISPR ATTTTCTCCCCTTTTCCTAC TGG (reversed) Intergenic
No off target data available for this crispr