ID: 910067853

View in Genome Browser
Species Human (GRCh38)
Location 1:83174811-83174833
Sequence ATGGTGTTAAAGGAGAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910067850_910067853 -2 Left 910067850 1:83174790-83174812 CCAGTAGGAAAAGGGGAGAAAAT No data
Right 910067853 1:83174811-83174833 ATGGTGTTAAAGGAGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910067853 Original CRISPR ATGGTGTTAAAGGAGAGACA AGG Intergenic
No off target data available for this crispr