ID: 910072741

View in Genome Browser
Species Human (GRCh38)
Location 1:83238649-83238671
Sequence CTGCTTCCACTGATTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910072741_910072745 7 Left 910072741 1:83238649-83238671 CCTTCCACAATCAGTGGAAGCAG No data
Right 910072745 1:83238679-83238701 CCTTCACTAGAAGCAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910072741 Original CRISPR CTGCTTCCACTGATTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr