ID: 910073171

View in Genome Browser
Species Human (GRCh38)
Location 1:83243866-83243888
Sequence CAGGTTACACTGTTCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910073171_910073173 -6 Left 910073171 1:83243866-83243888 CCATGTCAGAACAGTGTAACCTG No data
Right 910073173 1:83243883-83243905 AACCTGTTTGTACAAGGAAAAGG No data
910073171_910073175 3 Left 910073171 1:83243866-83243888 CCATGTCAGAACAGTGTAACCTG No data
Right 910073175 1:83243892-83243914 GTACAAGGAAAAGGACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910073171 Original CRISPR CAGGTTACACTGTTCTGACA TGG (reversed) Intergenic
No off target data available for this crispr