ID: 910080341 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:83334288-83334310 |
| Sequence | TAGGGTCCACCACCTGAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910080341_910080345 | -2 | Left | 910080341 | 1:83334288-83334310 | CCCAGCTCAGGTGGTGGACCCTA | No data | ||
| Right | 910080345 | 1:83334309-83334331 | TACTTAGCCTAAACTTGTAATGG | No data | ||||
| 910080341_910080349 | 30 | Left | 910080341 | 1:83334288-83334310 | CCCAGCTCAGGTGGTGGACCCTA | No data | ||
| Right | 910080349 | 1:83334341-83334363 | AAGATTTCACATTGAAGCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910080341 | Original CRISPR | TAGGGTCCACCACCTGAGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||