ID: 910080341

View in Genome Browser
Species Human (GRCh38)
Location 1:83334288-83334310
Sequence TAGGGTCCACCACCTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910080341_910080345 -2 Left 910080341 1:83334288-83334310 CCCAGCTCAGGTGGTGGACCCTA No data
Right 910080345 1:83334309-83334331 TACTTAGCCTAAACTTGTAATGG No data
910080341_910080349 30 Left 910080341 1:83334288-83334310 CCCAGCTCAGGTGGTGGACCCTA No data
Right 910080349 1:83334341-83334363 AAGATTTCACATTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910080341 Original CRISPR TAGGGTCCACCACCTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr