ID: 910086818

View in Genome Browser
Species Human (GRCh38)
Location 1:83412841-83412863
Sequence TGCCGAAGGCCAGTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910086809_910086818 13 Left 910086809 1:83412805-83412827 CCTTCAAACCCCAGGAACAGGTG No data
Right 910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG No data
910086811_910086818 4 Left 910086811 1:83412814-83412836 CCCAGGAACAGGTGCTTTAAGTT No data
Right 910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG No data
910086812_910086818 3 Left 910086812 1:83412815-83412837 CCAGGAACAGGTGCTTTAAGTTA No data
Right 910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG No data
910086808_910086818 14 Left 910086808 1:83412804-83412826 CCCTTCAAACCCCAGGAACAGGT No data
Right 910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG No data
910086806_910086818 15 Left 910086806 1:83412803-83412825 CCCCTTCAAACCCCAGGAACAGG No data
Right 910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG No data
910086810_910086818 5 Left 910086810 1:83412813-83412835 CCCCAGGAACAGGTGCTTTAAGT No data
Right 910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910086818 Original CRISPR TGCCGAAGGCCAGTGGGGCC TGG Intergenic
No off target data available for this crispr