ID: 910091669

View in Genome Browser
Species Human (GRCh38)
Location 1:83471777-83471799
Sequence CACACACACATGACTAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910091668_910091669 4 Left 910091668 1:83471750-83471772 CCAGCTAATAATGTGTGTGTGTG No data
Right 910091669 1:83471777-83471799 CACACACACATGACTAGAAGAGG No data
910091666_910091669 20 Left 910091666 1:83471734-83471756 CCCTCTACATGTATAGCCAGCTA No data
Right 910091669 1:83471777-83471799 CACACACACATGACTAGAAGAGG No data
910091667_910091669 19 Left 910091667 1:83471735-83471757 CCTCTACATGTATAGCCAGCTAA No data
Right 910091669 1:83471777-83471799 CACACACACATGACTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910091669 Original CRISPR CACACACACATGACTAGAAG AGG Intergenic
No off target data available for this crispr