ID: 910092102

View in Genome Browser
Species Human (GRCh38)
Location 1:83477921-83477943
Sequence AAGCAGTTATTTGTTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910092102_910092106 11 Left 910092102 1:83477921-83477943 CCATTACCAACAAATAACTGCTT No data
Right 910092106 1:83477955-83477977 ATACAACAAAGCACCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910092102 Original CRISPR AAGCAGTTATTTGTTGGTAA TGG (reversed) Intergenic
No off target data available for this crispr