ID: 910098713

View in Genome Browser
Species Human (GRCh38)
Location 1:83554070-83554092
Sequence ATTATGAGTTTTATTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910098713_910098715 -1 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098715 1:83554092-83554114 TGTTAGTGGTAGTTATCACTAGG No data
910098713_910098721 29 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098721 1:83554122-83554144 AATTGTGTAACTTGAGGGGCTGG No data
910098713_910098717 6 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098717 1:83554099-83554121 GGTAGTTATCACTAGGCAGTGGG No data
910098713_910098722 30 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098722 1:83554123-83554145 ATTGTGTAACTTGAGGGGCTGGG No data
910098713_910098720 25 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098720 1:83554118-83554140 TGGGAATTGTGTAACTTGAGGGG No data
910098713_910098719 24 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098719 1:83554117-83554139 GTGGGAATTGTGTAACTTGAGGG No data
910098713_910098718 23 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098718 1:83554116-83554138 AGTGGGAATTGTGTAACTTGAGG No data
910098713_910098716 5 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098716 1:83554098-83554120 TGGTAGTTATCACTAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910098713 Original CRISPR ATTATGAGTTTTATTCTTCA AGG (reversed) Intergenic