ID: 910098716

View in Genome Browser
Species Human (GRCh38)
Location 1:83554098-83554120
Sequence TGGTAGTTATCACTAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910098713_910098716 5 Left 910098713 1:83554070-83554092 CCTTGAAGAATAAAACTCATAAT No data
Right 910098716 1:83554098-83554120 TGGTAGTTATCACTAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910098716 Original CRISPR TGGTAGTTATCACTAGGCAG TGG Intergenic