ID: 910112436

View in Genome Browser
Species Human (GRCh38)
Location 1:83696983-83697005
Sequence CTGGAAGTGGAGAGGTAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910112436_910112439 -7 Left 910112436 1:83696983-83697005 CCAGGTTACCTCTCCACTTCCAG No data
Right 910112439 1:83696999-83697021 CTTCCAGCTATCACTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910112436 Original CRISPR CTGGAAGTGGAGAGGTAACC TGG (reversed) Intergenic
No off target data available for this crispr