ID: 910118644

View in Genome Browser
Species Human (GRCh38)
Location 1:83760353-83760375
Sequence AGCTTCAAAGAGATGAGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910118640_910118644 18 Left 910118640 1:83760312-83760334 CCAGTCTCTCTACAGCAGGGAGA No data
Right 910118644 1:83760353-83760375 AGCTTCAAAGAGATGAGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910118644 Original CRISPR AGCTTCAAAGAGATGAGCTA CGG Intergenic
No off target data available for this crispr