ID: 910120393

View in Genome Browser
Species Human (GRCh38)
Location 1:83782126-83782148
Sequence GTTCCAACCATTCCTAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910120393_910120397 19 Left 910120393 1:83782126-83782148 CCAGTCCTAGGAATGGTTGGAAC No data
Right 910120397 1:83782168-83782190 AAGTTTTCAGATCATAGCCAAGG No data
910120393_910120398 20 Left 910120393 1:83782126-83782148 CCAGTCCTAGGAATGGTTGGAAC No data
Right 910120398 1:83782169-83782191 AGTTTTCAGATCATAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910120393 Original CRISPR GTTCCAACCATTCCTAGGAC TGG (reversed) Intergenic
No off target data available for this crispr