ID: 910121268

View in Genome Browser
Species Human (GRCh38)
Location 1:83792881-83792903
Sequence CTAGGTTAACTCTAAGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910121259_910121268 12 Left 910121259 1:83792846-83792868 CCAGAGCCTTTATGAACTACCTG No data
Right 910121268 1:83792881-83792903 CTAGGTTAACTCTAAGATATGGG No data
910121257_910121268 20 Left 910121257 1:83792838-83792860 CCCGTGAGCCAGAGCCTTTATGA No data
Right 910121268 1:83792881-83792903 CTAGGTTAACTCTAAGATATGGG No data
910121263_910121268 -7 Left 910121263 1:83792865-83792887 CCTGAGGCCACCACCTCTAGGTT No data
Right 910121268 1:83792881-83792903 CTAGGTTAACTCTAAGATATGGG No data
910121258_910121268 19 Left 910121258 1:83792839-83792861 CCGTGAGCCAGAGCCTTTATGAA No data
Right 910121268 1:83792881-83792903 CTAGGTTAACTCTAAGATATGGG No data
910121261_910121268 6 Left 910121261 1:83792852-83792874 CCTTTATGAACTACCTGAGGCCA No data
Right 910121268 1:83792881-83792903 CTAGGTTAACTCTAAGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910121268 Original CRISPR CTAGGTTAACTCTAAGATAT GGG Intergenic
No off target data available for this crispr