ID: 910122929

View in Genome Browser
Species Human (GRCh38)
Location 1:83810338-83810360
Sequence CAGAAATAACTGGGGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910122929_910122935 -9 Left 910122929 1:83810338-83810360 CCTTACTTCCCCAGTTATTTCTG No data
Right 910122935 1:83810352-83810374 TTATTTCTGTTTTGGAGGAGAGG No data
910122929_910122939 21 Left 910122929 1:83810338-83810360 CCTTACTTCCCCAGTTATTTCTG No data
Right 910122939 1:83810382-83810404 CACAGATGTGTGAAGTGGCTGGG No data
910122929_910122938 20 Left 910122929 1:83810338-83810360 CCTTACTTCCCCAGTTATTTCTG No data
Right 910122938 1:83810381-83810403 CCACAGATGTGTGAAGTGGCTGG 0: 2
1: 0
2: 1
3: 17
4: 210
910122929_910122936 16 Left 910122929 1:83810338-83810360 CCTTACTTCCCCAGTTATTTCTG No data
Right 910122936 1:83810377-83810399 TGCTCCACAGATGTGTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910122929 Original CRISPR CAGAAATAACTGGGGAAGTA AGG (reversed) Intergenic
No off target data available for this crispr