ID: 910123877

View in Genome Browser
Species Human (GRCh38)
Location 1:83819402-83819424
Sequence CAGAGCAACCACTCACTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910123873_910123877 27 Left 910123873 1:83819352-83819374 CCATGTGGTAGAGAAGGAAGGAG No data
Right 910123877 1:83819402-83819424 CAGAGCAACCACTCACTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910123877 Original CRISPR CAGAGCAACCACTCACTAGA GGG Intergenic
No off target data available for this crispr