ID: 910131456

View in Genome Browser
Species Human (GRCh38)
Location 1:83912177-83912199
Sequence GGGTAAATTTTCATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910131451_910131456 23 Left 910131451 1:83912131-83912153 CCATGCTACATTTTAAAAATTAA 0: 1
1: 1
2: 11
3: 100
4: 1090
Right 910131456 1:83912177-83912199 GGGTAAATTTTCATGGAGGAAGG No data
910131450_910131456 24 Left 910131450 1:83912130-83912152 CCCATGCTACATTTTAAAAATTA 0: 1
1: 1
2: 8
3: 110
4: 910
Right 910131456 1:83912177-83912199 GGGTAAATTTTCATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910131456 Original CRISPR GGGTAAATTTTCATGGAGGA AGG Intronic
No off target data available for this crispr