ID: 910135938

View in Genome Browser
Species Human (GRCh38)
Location 1:83969995-83970017
Sequence CAAATTGTGACATGTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910135938_910135939 -6 Left 910135938 1:83969995-83970017 CCTGCTTCACATGTCACAATTTG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 910135939 1:83970012-83970034 AATTTGTTTTTTGAAAATTCAGG 0: 1
1: 0
2: 17
3: 201
4: 1613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910135938 Original CRISPR CAAATTGTGACATGTGAAGC AGG (reversed) Intronic
902894541 1:19469953-19469975 TAACATGTGACATGTGAAGACGG - Intronic
904929123 1:34072568-34072590 CCAATTGTGAGAAGTGATGCAGG + Intronic
910085698 1:83399629-83399651 CACATAGTGACAAGTGAAACTGG - Intergenic
910135938 1:83969995-83970017 CAAATTGTGACATGTGAAGCAGG - Intronic
911410030 1:97492432-97492454 CAAATTGTGTTATGTGAATAGGG - Intronic
915072317 1:153280526-153280548 AAAATTTTGACATGCCAAGCAGG - Intergenic
915072452 1:153281892-153281914 AAAATTTTGACATGCCAAGCAGG + Intergenic
915641327 1:157229333-157229355 CATTTTGTGCCATCTGAAGCAGG - Intergenic
915668166 1:157463600-157463622 CATTTTGTGCCATGTGGAGCAGG + Intergenic
915922993 1:159991841-159991863 CAAATAATGACTTGTGAATCAGG - Intergenic
916414873 1:164583230-164583252 CAAATTCTAAAAGGTGAAGCTGG - Intronic
918384131 1:183987854-183987876 CAAATTGTTTCAAGAGAAGCTGG + Intronic
919391806 1:196994655-196994677 AAAATAGTGCCATCTGAAGCAGG - Intronic
919543481 1:198880862-198880884 TGAATTGTGACAAGTGAAGGTGG + Intergenic
919753752 1:201053902-201053924 GAGATTGTGAGATGTGCAGCAGG - Intronic
923350065 1:233095833-233095855 CGAACTGTAACTTGTGAAGCAGG + Exonic
924780754 1:247145216-247145238 CAAATTGTAACATATGGATCAGG + Intronic
1062795248 10:340396-340418 AAAATGCTGAAATGTGAAGCTGG + Intronic
1065491989 10:26291483-26291505 TGACTTGTGACATCTGAAGCAGG - Intronic
1067413278 10:46083961-46083983 CAAATAGTGACTAGTGAAGTTGG - Intergenic
1069363802 10:67674880-67674902 CAAAGAGGGACATATGAAGCAGG - Intronic
1070687687 10:78501756-78501778 CAAATACTCACATGTGAAGGAGG - Intergenic
1070920879 10:80185340-80185362 CAACTTGTAAGATATGAAGCTGG - Intronic
1075572874 10:123558284-123558306 CAGTCTCTGACATGTGAAGCTGG - Intergenic
1076232275 10:128831329-128831351 CAAATTTTGATATGTGCAGGGGG - Intergenic
1076578594 10:131491214-131491236 CAAATTGTGAGTTGTGAAATGGG + Intergenic
1076623323 10:131806837-131806859 CAGATGGGGACATGAGAAGCCGG + Intergenic
1076712057 10:132342249-132342271 CAAAATGTTACCTGTGGAGCTGG + Exonic
1083229550 11:61307490-61307512 CAAAGGGTGACTTGTGAAGTAGG - Intronic
1085920436 11:80948704-80948726 CTAATTGTGCCATGCTAAGCTGG - Intergenic
1086891148 11:92259675-92259697 CAAGTTGTTAGATGTGGAGCAGG - Intergenic
1087928433 11:103947850-103947872 CAAATGGTGACCTGTTCAGCAGG - Intronic
1088196251 11:107277121-107277143 AAAATTGTGAAATGTGGAGAGGG - Intergenic
1088245144 11:107810985-107811007 CAAACTGTGACATCTAAACCTGG + Intronic
1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG + Intronic
1098266267 12:68723696-68723718 AAAAGTGTGACATTTGAGGCTGG - Intronic
1102092870 12:110207850-110207872 CAAAATGTGAGATTTAAAGCAGG - Intronic
1105888697 13:24665884-24665906 CAAAGTGTGACTAGTGATGCTGG - Intergenic
1106007259 13:25782563-25782585 CAAATTTTGGCATCTGAAGGTGG - Intronic
1106919819 13:34551588-34551610 CAATTTGTGCCATGTGAAGTAGG + Intergenic
1107271126 13:38617798-38617820 CATAATGTGAACTGTGAAGCTGG - Intergenic
1109011103 13:56945558-56945580 AAAATTATGAAATGTCAAGCAGG - Intergenic
1109684062 13:65790378-65790400 CAAATTTTGACATGCAAACCTGG + Intergenic
1110196436 13:72793863-72793885 CAATTTGGGACATGTTAAGTTGG + Intronic
1111661100 13:91212818-91212840 CAAATTGTGACATGGAAACTTGG + Intergenic
1112659898 13:101496016-101496038 TAAATTGTGGAATTTGAAGCTGG - Intronic
1117062964 14:51981579-51981601 CACAGTGTGGCCTGTGAAGCTGG - Intergenic
1119252866 14:73171946-73171968 CAAATTGTGACAAGTGAGAAAGG - Intronic
1127135201 15:55913198-55913220 CAACTTGTTAAATGTGAATCCGG + Intronic
1128160359 15:65419745-65419767 CAAATTCTGACTTGGGAAGAAGG + Intronic
1137438450 16:48477917-48477939 CAAAGTGTAAGATGTGAAGAGGG + Intergenic
1138170352 16:54843704-54843726 CAAATACTTACATGTGAACCAGG - Intergenic
1138278825 16:55757082-55757104 CAGATTGTGATGGGTGAAGCTGG - Intergenic
1139101671 16:63774676-63774698 CTGATTGTGACATGTGGTGCTGG + Intergenic
1149382770 17:56110415-56110437 CAAATTGTGATGTGTGATGAAGG - Intergenic
1152412897 17:80138468-80138490 CACATTGTGAAATGTTAAGTAGG - Intronic
1154156104 18:11945461-11945483 CAAATTGTTACAGGTGATGCAGG - Intergenic
1155781235 18:29838755-29838777 CAACTTGTGACCTGTGTACCTGG + Intergenic
1156093282 18:33497621-33497643 TAAATTGTGCCATGTTAAGATGG + Intergenic
1161772470 19:6238599-6238621 CAAATTGAGAGCTGTGAGGCAGG - Intronic
1164031540 19:21411417-21411439 CAAATTATAAAATGTTAAGCAGG + Intronic
1164079204 19:21848115-21848137 CAAATTGTTACATATAAGGCCGG - Intronic
1168662493 19:58178795-58178817 CAAATTGTTCCATGTAAAGGGGG - Intergenic
924975819 2:173602-173624 TTAATAGTGACATGTGAAGAAGG - Intergenic
926672435 2:15588743-15588765 CAAATTGGGATATGTGAATTGGG - Intergenic
926985047 2:18613345-18613367 CAAAGTCTGATGTGTGAAGCAGG - Intergenic
927677023 2:25113805-25113827 CTAACTGTGACAGGTGAGGCAGG + Intronic
928291592 2:30042919-30042941 GTAATTGTGACATTTGGAGCTGG - Intergenic
928605396 2:32941183-32941205 CAAATCATCGCATGTGAAGCAGG - Intergenic
929938645 2:46313745-46313767 TAAATTATGACATGTGGGGCTGG - Intronic
930390379 2:50753557-50753579 AATACTGTGTCATGTGAAGCTGG - Intronic
932797775 2:74712407-74712429 CAAATGGGGACATGGGAAGAGGG + Intergenic
939754143 2:146088631-146088653 CATATTCTGCCATGGGAAGCGGG - Intergenic
941327877 2:164140423-164140445 CAACTTTAGATATGTGAAGCTGG - Intergenic
945631475 2:212283318-212283340 CAAATTGTGCCATATGATACCGG - Intronic
946921826 2:224588149-224588171 CAAACTGTGAGATGTGAAAAAGG - Intergenic
948169901 2:235892888-235892910 CAGATTTTCAGATGTGAAGCTGG + Intronic
1170695440 20:18653780-18653802 GAAATTGTTATATGTGAAGGAGG + Intronic
1173435725 20:43030693-43030715 CAAATGGAGACATCTAAAGCAGG + Intronic
1173617747 20:44413940-44413962 CAAACTGGGCCATGTGAAACCGG - Intronic
1177381806 21:20354136-20354158 CAAATAATCACATGTGAAGATGG - Intergenic
1179040973 21:37801999-37802021 CAACTTGTGAGTGGTGAAGCTGG + Intronic
1179290803 21:40016206-40016228 TAAATTGTGAGATATGAAGGGGG + Intronic
1181969014 22:26676164-26676186 TAAATGGTGACATGTTGAGCTGG + Intergenic
1182856690 22:33523587-33523609 CAAATGGTGACATTTAAAACAGG - Intronic
949438881 3:4058884-4058906 CAATTTGTGAGATGTCAATCTGG + Intronic
950267430 3:11584948-11584970 CAAGTTGTGACACTTGGAGCCGG - Intronic
951354315 3:21645525-21645547 CAAATTGCGAGATTTAAAGCTGG + Intronic
953126231 3:40094052-40094074 AAAATTGGGACATGTGAAGGGGG - Intronic
953336802 3:42100380-42100402 AAAATGGTGACAGGTGAGGCAGG + Intronic
953954894 3:47224238-47224260 CAGAATGTGACATTTAAAGCCGG + Intergenic
954186142 3:48918595-48918617 CAAACAGTGAAATGAGAAGCCGG + Exonic
956311108 3:67881516-67881538 CCACTTGTGGCATGTGAAACAGG + Intergenic
962086894 3:132200770-132200792 TCAATTGTGACATGTGAAAATGG + Intronic
963447603 3:145434460-145434482 CAAAGTGTGAAATGGGAAGTTGG - Intergenic
964031163 3:152140587-152140609 CAAATGGTGTCATTTGAGGCAGG + Intergenic
968546810 4:1203065-1203087 CGAATTCTGCCATGTGAGGCTGG + Intronic
970916230 4:21338351-21338373 TACATTGTGACATGGGAACCTGG + Intronic
971378892 4:26078592-26078614 CAAATAGTGGCATGTCAAGCGGG + Intergenic
978806323 4:112804609-112804631 TAAATTGTAACATGTGAGGTGGG + Intergenic
979588455 4:122449072-122449094 CAAATTGTGACATAAGAAAATGG - Intergenic
982333366 4:154207157-154207179 TAAAATGTGACAGGTGTAGCTGG - Intergenic
984921834 4:184771456-184771478 CAAATTGTGATATGTAAAGTAGG - Intronic
985028578 4:185764838-185764860 CAATTAGAGACATGTGCAGCAGG - Intronic
986293625 5:6419675-6419697 TAAATTGTAAAATGTGAAGCTGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
991631097 5:68657064-68657086 CAAATGCAGACATGTGAAGCTGG + Intergenic
992283694 5:75209820-75209842 CAAATTGTGTTAAGTGAAACTGG + Intronic
995159413 5:108960821-108960843 CAATTTATGACTTGAGAAGCTGG - Intronic
997668864 5:135654072-135654094 CCAATTGTGACATTTTCAGCAGG + Intergenic
997806766 5:136925666-136925688 CAAAATGTGACTTGTGCTGCAGG + Intergenic
998627807 5:143865273-143865295 CAAATTGTTATCTGGGAAGCTGG + Intergenic
998924121 5:147103793-147103815 CAAATATTGATATGTGAAGATGG + Intergenic
1006135688 6:31895106-31895128 CAACCTGTGCTATGTGAAGCAGG + Intronic
1006956338 6:37876124-37876146 CAAATTGGAAAAGGTGAAGCAGG + Intronic
1009473447 6:64057452-64057474 GAAATTGTTATATGTGAAGGTGG - Intronic
1012978650 6:105806966-105806988 GAAAATGTGACATGTGAATCTGG + Intergenic
1014670940 6:124303003-124303025 CATATTTTGGCCTGTGAAGCAGG + Intronic
1025174965 7:56794747-56794769 AGAATTGAGGCATGTGAAGCTGG + Intergenic
1025696838 7:63781668-63781690 AGAATTGAGGCATGTGAAGCTGG - Intergenic
1027302574 7:76856090-76856112 CACATAGTGACAAGTGAAACTGG - Intergenic
1030993802 7:116334086-116334108 CTATTTGTGAGATGTGAGGCTGG - Intronic
1037657862 8:20901902-20901924 CAAATTGTGATATATGAACAAGG - Intergenic
1039978220 8:42384809-42384831 CAGTTAGTGACATGTGTAGCAGG - Intergenic
1043450102 8:80357667-80357689 CAAATTGTGACTAGTGTAGTAGG - Intergenic
1043573903 8:81634614-81634636 CCAAATGAGAAATGTGAAGCAGG + Intergenic
1046098957 8:109592739-109592761 CAACTAGTGACAGGTGGAGCTGG - Intronic
1047690743 8:127351969-127351991 CAAACAGTGACAGCTGAAGCTGG + Intergenic
1050605785 9:7299815-7299837 CAAATTATCACAAATGAAGCAGG + Intergenic
1053526804 9:38838489-38838511 CAAATGCTGGCAGGTGAAGCAGG + Intergenic
1054199032 9:62062919-62062941 CAAATGCTGGCAGGTGAAGCAGG + Intergenic
1054639323 9:67525438-67525460 CAAATGCTGGCAGGTGAAGCAGG - Intergenic
1058642731 9:107103024-107103046 CACATTGTGACATTTCAAGCAGG - Intergenic
1190711934 X:53077727-53077749 CCTACTGTGTCATGTGAAGCAGG + Exonic
1191152110 X:57230264-57230286 CAAATTATGACATGTGACTCAGG + Intergenic
1195115134 X:101689780-101689802 GAAAATGTGACATGTGACCCTGG - Intergenic
1195821711 X:108952408-108952430 AAAATTGTGACATGTTAAATGGG - Intergenic