ID: 910143039

View in Genome Browser
Species Human (GRCh38)
Location 1:84047613-84047635
Sequence TGAAACCAGTGTGAAAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910143039_910143040 -1 Left 910143039 1:84047613-84047635 CCTACTCTTTCACACTGGTTTCA No data
Right 910143040 1:84047635-84047657 ATTCATTTATTCATTCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910143039 Original CRISPR TGAAACCAGTGTGAAAGAGT AGG (reversed) Intergenic
No off target data available for this crispr