ID: 910159180

View in Genome Browser
Species Human (GRCh38)
Location 1:84255264-84255286
Sequence ATGACCTAATCACCTCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9310
Summary {0: 308, 1: 994, 2: 1917, 3: 2628, 4: 3463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910159180_910159183 1 Left 910159180 1:84255264-84255286 CCTTTGGGAGGTGATTAGGTCAT 0: 308
1: 994
2: 1917
3: 2628
4: 3463
Right 910159183 1:84255288-84255310 AGAGTGGAGCCCTCATAAATGGG No data
910159180_910159186 24 Left 910159180 1:84255264-84255286 CCTTTGGGAGGTGATTAGGTCAT 0: 308
1: 994
2: 1917
3: 2628
4: 3463
Right 910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG No data
910159180_910159182 0 Left 910159180 1:84255264-84255286 CCTTTGGGAGGTGATTAGGTCAT 0: 308
1: 994
2: 1917
3: 2628
4: 3463
Right 910159182 1:84255287-84255309 GAGAGTGGAGCCCTCATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910159180 Original CRISPR ATGACCTAATCACCTCCCAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr