ID: 910159184

View in Genome Browser
Species Human (GRCh38)
Location 1:84255297-84255319
Sequence GGCAATGGTCCCATTTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910159184_910159190 7 Left 910159184 1:84255297-84255319 CCCTCATAAATGGGACCATTGCC No data
Right 910159190 1:84255327-84255349 TAAGAGGCTTGAGAGCTAACTGG No data
910159184_910159186 -9 Left 910159184 1:84255297-84255319 CCCTCATAAATGGGACCATTGCC No data
Right 910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910159184 Original CRISPR GGCAATGGTCCCATTTATGA GGG (reversed) Intergenic
No off target data available for this crispr