ID: 910159186

View in Genome Browser
Species Human (GRCh38)
Location 1:84255311-84255333
Sequence ACCATTGCCCTTATAATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910159180_910159186 24 Left 910159180 1:84255264-84255286 CCTTTGGGAGGTGATTAGGTCAT 0: 308
1: 994
2: 1917
3: 2628
4: 3463
Right 910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG No data
910159184_910159186 -9 Left 910159184 1:84255297-84255319 CCCTCATAAATGGGACCATTGCC No data
Right 910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG No data
910159185_910159186 -10 Left 910159185 1:84255298-84255320 CCTCATAAATGGGACCATTGCCC No data
Right 910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910159186 Original CRISPR ACCATTGCCCTTATAATAAG AGG Intergenic
No off target data available for this crispr