ID: 910161892

View in Genome Browser
Species Human (GRCh38)
Location 1:84281701-84281723
Sequence GATAAGAGGTTTAACTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910161892_910161894 10 Left 910161892 1:84281701-84281723 CCTGGGGAGTTAAACCTCTTATC No data
Right 910161894 1:84281734-84281756 AATCTCTTTTGTCTATCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910161892 Original CRISPR GATAAGAGGTTTAACTCCCC AGG (reversed) Intergenic
No off target data available for this crispr