ID: 910162056

View in Genome Browser
Species Human (GRCh38)
Location 1:84283729-84283751
Sequence CAGCACAAGGAGACAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910162056_910162058 -9 Left 910162056 1:84283729-84283751 CCAGCTTCTGTCTCCTTGTGCTG No data
Right 910162058 1:84283743-84283765 CTTGTGCTGCATTCTGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910162056 Original CRISPR CAGCACAAGGAGACAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr