ID: 910163171

View in Genome Browser
Species Human (GRCh38)
Location 1:84295953-84295975
Sequence CTGGCTAGAAAAATCTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910163165_910163171 27 Left 910163165 1:84295903-84295925 CCCTAATAAGCCTGTCCTTTGAA 0: 1
1: 0
2: 1
3: 15
4: 156
Right 910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG 0: 1
1: 0
2: 1
3: 14
4: 212
910163167_910163171 17 Left 910163167 1:84295913-84295935 CCTGTCCTTTGAAGCTTTGAAGT 0: 21
1: 292
2: 556
3: 579
4: 521
Right 910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG 0: 1
1: 0
2: 1
3: 14
4: 212
910163166_910163171 26 Left 910163166 1:84295904-84295926 CCTAATAAGCCTGTCCTTTGAAG 0: 1
1: 0
2: 3
3: 9
4: 143
Right 910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG 0: 1
1: 0
2: 1
3: 14
4: 212
910163164_910163171 28 Left 910163164 1:84295902-84295924 CCCCTAATAAGCCTGTCCTTTGA 0: 1
1: 0
2: 3
3: 16
4: 130
Right 910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG 0: 1
1: 0
2: 1
3: 14
4: 212
910163169_910163171 12 Left 910163169 1:84295918-84295940 CCTTTGAAGCTTTGAAGTTAGGC 0: 2
1: 50
2: 349
3: 549
4: 620
Right 910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG 0: 1
1: 0
2: 1
3: 14
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910163171 Original CRISPR CTGGCTAGAAAAATCTTACA TGG Intergenic
900355011 1:2256879-2256901 CTGGCAACAAAAACCTGACAAGG - Intronic
901117001 1:6855016-6855038 ATGGCAAGAAAAATAGTACAGGG + Intronic
901261237 1:7872857-7872879 CTAGCTAGGAAAGTCTTAGACGG - Intergenic
903561061 1:24227963-24227985 CTAGCTATGAAAATCTTAGATGG + Intergenic
904331843 1:29763935-29763957 CTTGATACAAAAATCTGACAAGG + Intergenic
905217154 1:36416872-36416894 CTGGCTGGAGACATTTTACATGG + Intronic
905847905 1:41248560-41248582 CTGGCTAGGAGGATCTTCCAAGG - Intergenic
908091736 1:60693128-60693150 CTAGCTAGTAAAGTCTTAGATGG - Intergenic
910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG + Intergenic
910187631 1:84560614-84560636 CTAGCTAGCAAAGTCTTAAATGG - Intronic
910571329 1:88707789-88707811 CTGGTTAGAAAAATATGACCAGG - Intronic
911668356 1:100581168-100581190 TTGACTAGAAAAGTCTTACTGGG + Intergenic
912307237 1:108580940-108580962 CTAGCTACAAAAGTCTTAGATGG - Intronic
913386523 1:118263715-118263737 CTGGAGAGAAAATTCTAACAAGG + Intergenic
913666339 1:121052095-121052117 CTGGATGGAAAACTCTTTCAAGG - Intergenic
914018024 1:143839207-143839229 CTGGATGGAAAACTCTTTCAAGG - Intergenic
914656637 1:149747740-149747762 CTGGATGGAAAACTCTTTCAAGG - Intergenic
915877711 1:159629907-159629929 CAGGATAGAGAAATATTACAAGG + Intergenic
916831858 1:168501139-168501161 CTAGCTACAAAAGTCTTAGATGG + Intergenic
918295968 1:183157515-183157537 CATGCTACAAAAATATTACATGG - Intergenic
921252517 1:213311084-213311106 CTGACAAGAAATGTCTTACATGG + Intergenic
921571772 1:216788215-216788237 CTGGCTATAAAAGTCCTAGATGG - Intronic
921887766 1:220323709-220323731 TTGACCAGAAAAGTCTTACAGGG + Intergenic
924211402 1:241771208-241771230 CTGGAAAGAATAAACTTACATGG + Intronic
924549562 1:245062927-245062949 CTGGCTAGCAAATCATTACATGG + Intronic
1066702532 10:38145429-38145451 CTGGCAAGAAAATTATTAAAGGG - Intergenic
1067858533 10:49819883-49819905 CTGTCTATAAAAATCTAAAATGG - Intronic
1069324438 10:67215610-67215632 ATGGCTAGAAAATTCCAACATGG + Intronic
1072021263 10:91404963-91404985 TTGGCTAGAATAATGTTACATGG + Intergenic
1074029149 10:109666896-109666918 CTGTCAAGAAAAAACTTTCAAGG + Intergenic
1074468138 10:113702612-113702634 CTAGCTAGGACAATCTTAGATGG - Intronic
1080069813 11:28068529-28068551 TTGGCTAGAAATATGTCACATGG - Intronic
1080630021 11:34065959-34065981 GTGGTTAGAAAAATGTTATATGG + Intronic
1083035498 11:59633501-59633523 CTGTCTAGAAAAATTTAAAAAGG - Intergenic
1086822819 11:91455882-91455904 CTCCCTAAAAAAATCTTAAAAGG + Intergenic
1088462884 11:110101385-110101407 CTAGCTATAAAAGTCTTAGATGG - Intronic
1090853505 11:130591600-130591622 CTGGCTTCAAAAATATGACAAGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092382344 12:8007257-8007279 CTGGCTATAAAAGTCCTAGATGG - Intergenic
1093008149 12:14073730-14073752 CTGGCTCCAAAAATCTCACTAGG + Intergenic
1093593487 12:20934794-20934816 CTGGCTGTAAAAATCAGACAAGG - Intergenic
1095447486 12:42296657-42296679 CTGGCAAGAGAAAACTTAAAAGG - Intronic
1095688070 12:45058249-45058271 CTGGCTATGAAAGTCCTACATGG + Intergenic
1096007213 12:48183302-48183324 CGGGCTGGAAAAATCTTTCCAGG + Intergenic
1097498069 12:60367917-60367939 CTGACTACAAATATATTACAAGG + Intergenic
1098577907 12:72064994-72065016 CTTGTTATAAAAATCTTATATGG - Intronic
1100355423 12:93824452-93824474 CAGGCTAAAAGAATATTACATGG + Intronic
1100443487 12:94639802-94639824 CAGGCTATAAAAATCTCACTCGG + Intronic
1103575499 12:121874249-121874271 GTGGCTAGAAAATGCTTACATGG + Intergenic
1104405733 12:128515181-128515203 ATGGCTAGAAACAGGTTACACGG - Intronic
1106019592 13:25901761-25901783 CAGGCTAGAACAAGCCTACACGG - Intronic
1108842037 13:54630261-54630283 CTTGTGAGAGAAATCTTACAAGG - Intergenic
1110411605 13:75209793-75209815 CTGGCTAGGAAAGTCCTAGATGG + Intergenic
1112097512 13:96151071-96151093 CTGGCTAGAATTATTTCACATGG - Intronic
1112195032 13:97217517-97217539 CTGGATAGAAAGATGTTAGATGG + Intergenic
1112771332 13:102798412-102798434 TTGGAAAGAAAAATCTTAAAGGG + Intronic
1117221400 14:53610239-53610261 CTGGCTAGGAAAAGCCTTCATGG - Intergenic
1117709553 14:58511248-58511270 CTAGCTAAAGAAATCTAACAAGG - Intronic
1117935458 14:60900698-60900720 CTGGCTATGAAAATCCTAGATGG - Intronic
1118104883 14:62647213-62647235 TTGGCTAGAATAATGTCACATGG - Intergenic
1118565146 14:67131474-67131496 CAGTCCAGAAGAATCTTACAGGG + Intronic
1118713741 14:68544563-68544585 CTGTCAAGAAAAATCTGAAATGG + Intronic
1123138675 14:106054507-106054529 CTGGCTAGGCAAATCCTACAGGG - Intergenic
1125000450 15:34764684-34764706 CTAGCTATAAAAGTCCTACATGG + Intergenic
1125317270 15:38444494-38444516 CTGGGGAGAAAAATCTTTTAAGG + Intergenic
1127617638 15:60702658-60702680 CTAGCTTGGAAAATTTTACAAGG + Intronic
1128590664 15:68894050-68894072 CTATCAAGAAAAATATTACAAGG - Intronic
1128690055 15:69717400-69717422 CTGGCTAGGAAAACCCTAGATGG + Intergenic
1131086325 15:89578576-89578598 CTGGCTAGAAATAAGTTAGATGG + Intronic
1132920592 16:2388430-2388452 CGGGCCTGAAAAATCATACATGG + Intergenic
1133092976 16:3419215-3419237 CTAGCTACAAAAGTCTTAGATGG + Intronic
1133150803 16:3828052-3828074 CTGGCTAGAAAAATGTGCCTTGG - Intronic
1138073062 16:54012554-54012576 CTAGCTATAAAAATGCTACATGG - Intronic
1138518305 16:57552296-57552318 CTGGCTATGAAACTCTTAGATGG + Intronic
1139022135 16:62762950-62762972 TTGGCAAGAAATATCTTACCAGG - Intergenic
1144502221 17:15798577-15798599 CTGGCCATAAAAATCCCACATGG + Intergenic
1144593509 17:16545391-16545413 TTGGCAAGTAAAATTTTACATGG + Intergenic
1145164401 17:20601237-20601259 CTGGCCATAAAAATCCCACATGG + Intergenic
1147027837 17:37603912-37603934 CTAGCTAGGAAAGTCTTAGATGG + Intronic
1147541968 17:41367889-41367911 ATGGTTAGGAAAATCTTACTTGG + Exonic
1149147987 17:53520894-53520916 CTAGCTATGAAAATCTTAGATGG + Intergenic
1149826352 17:59832118-59832140 GTGGGTAGAAAAATCTTAGTGGG - Intronic
1150938943 17:69669330-69669352 TTTCCAAGAAAAATCTTACATGG - Intergenic
1152041369 17:77906020-77906042 CTGGCTTGAAAAGACTTACCCGG + Intergenic
1152085425 17:78214786-78214808 CTGGCCAGAGAAGACTTACATGG - Exonic
1153973143 18:10244685-10244707 GTGGCTACAAAACTCTTGCAAGG - Intergenic
1155389984 18:25325153-25325175 GAGGCTGGAAAAATCTTACAAGG - Intronic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1157349664 18:46873167-46873189 CAGGTTAGAACAATCTTAAAAGG + Intronic
1159963390 18:74573321-74573343 ATGGATAGAAAAATGATACATGG - Intronic
1160097087 18:75884111-75884133 CTGGCTATGAAAGTCCTACATGG + Intergenic
1166581868 19:43908092-43908114 CTAGCTTCAAAAATCTTCCAGGG + Intergenic
1168533226 19:57146695-57146717 CTAGCTATAAAAATCCTAGATGG - Intergenic
925134528 2:1516841-1516863 CTGGTTAGAAGAACCTTCCAGGG - Intronic
925459040 2:4044099-4044121 CTGTCTAGATAAATTCTACATGG - Intergenic
926472661 2:13280379-13280401 CTGGCTAGAACAATATCTCAGGG - Intergenic
926543458 2:14209322-14209344 CTCGCTAGAAAAATCTTACCTGG + Intergenic
926600387 2:14837402-14837424 CTGGATAGCAAAATCAGACAAGG - Intergenic
929393947 2:41500634-41500656 TTGGCAAGTAAAATTTTACATGG + Intergenic
931490152 2:62736892-62736914 CTATCAAGAAAAATATTACAAGG - Intronic
933996440 2:87673448-87673470 CTGGCTGGAAAAACCTTTTAAGG + Intergenic
935591236 2:104847009-104847031 TTAGCTAGAAAAATATTCCAAGG - Intergenic
936297413 2:111277462-111277484 CTGGCTGGAAAAACCTTTTAAGG - Intergenic
937628602 2:124072373-124072395 CTAGCTAGAACAATCAAACAAGG + Intronic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
940134518 2:150421528-150421550 GTGACAGGAAAAATCTTACATGG - Intergenic
941265053 2:163350776-163350798 CTGGTTAGAAATATTTTTCATGG + Intergenic
943270318 2:185793152-185793174 GTGGCTAGAAGAAATTTACAAGG + Exonic
944130276 2:196340267-196340289 CTGGCTAGAGCATTCTTAAAGGG - Intronic
944420233 2:199522566-199522588 CTGGCCAGAAATTTCTAACATGG + Intergenic
945575153 2:211521637-211521659 CTGGCTATAAAAATCCTAGATGG - Intronic
945680983 2:212914096-212914118 CAGGCTAGAAAATGCTGACATGG - Intergenic
945685138 2:212959720-212959742 CTGGCTAGTAACTCCTTACATGG + Intergenic
946091595 2:217229768-217229790 CTGGCTATAAAAGCCTTAGATGG + Intergenic
948006816 2:234616507-234616529 CTGGCTAGAGAAAACTTGAAAGG - Intergenic
1169917402 20:10697239-10697261 CTAGGTAGAAAATTCTAACAAGG - Intergenic
1176964023 21:15192062-15192084 CCGGGTAGAAAAATCTTAATAGG - Intergenic
1177024120 21:15900639-15900661 CTAGCTAGAACAATCAGACAAGG + Intergenic
1177583535 21:23059272-23059294 CGTGCTAGAAAAAGCTTAGATGG + Intergenic
1178435793 21:32557164-32557186 TTGGGTATAAAAATCATACAGGG + Intergenic
1180658128 22:17441733-17441755 CTGGTTTGAAGAATTTTACATGG + Intronic
949153784 3:803348-803370 ATAGCTAGATAAATCTCACAGGG - Intergenic
951975143 3:28498444-28498466 ATGTCTATAAAAATCATACAGGG - Intronic
952635648 3:35526834-35526856 CTAGCTAGGAAAATCTTAGAGGG + Intergenic
954854521 3:53632099-53632121 CTAGCTAGAAAAATCGTCGATGG + Intronic
955314273 3:57922377-57922399 AGGGCCAGAAAATTCTTACATGG + Intronic
955604193 3:60682321-60682343 CTAGCTAGGAAAATCCTAGATGG - Intronic
962052167 3:131827869-131827891 CAGCCTAGGAAAATCATACAAGG - Intronic
965988908 3:174791599-174791621 CTGGGGAGAATATTCTTACATGG - Intronic
966017803 3:175164626-175164648 CTGGATAGAAAAATATTAACTGG + Intronic
966151927 3:176875130-176875152 CTGGCTAGAAAACACTCGCAAGG + Intergenic
966160780 3:176965936-176965958 CTGGCTAGTAAAATCCAATAAGG - Intergenic
967543078 3:190691765-190691787 TGGGCTAGAGATATCTTACAAGG + Intergenic
969359194 4:6650966-6650988 CTGGGCAGAAAAATTTTGCAGGG + Intergenic
971655035 4:29333214-29333236 CTGGCCAGAGAAATCATAGAGGG - Intergenic
971868626 4:32206705-32206727 CTAGCTATGAAAGTCTTACATGG - Intergenic
973680446 4:53312623-53312645 CTAGGAAGAAAAATGTTACAGGG - Intronic
974656010 4:64823459-64823481 CTGGCTAGGAAAATTTTATAAGG + Intergenic
975324703 4:73046166-73046188 CTGGCTATCAAAATCCTAGATGG + Intergenic
975731565 4:77342667-77342689 CAGGCTAGAAACATAGTACAAGG + Intronic
976667411 4:87611521-87611543 CTGGCTAGTAAAATTATAAATGG - Intronic
976835355 4:89366484-89366506 CTAGCTATAAAAGTCTTGCATGG - Intergenic
977528735 4:98174987-98175009 TTGGCTAGAAACATATCACATGG + Intergenic
977938924 4:102837203-102837225 CTGGCTTGTAACAGCTTACAAGG + Intronic
978500908 4:109409099-109409121 CTGGGGAGATTAATCTTACAAGG + Intergenic
979271814 4:118771372-118771394 CTGGCTATAAAAACCTCACCTGG + Intronic
982148142 4:152420980-152421002 CCAGCTAGAAAAGTCTTAGATGG + Intronic
982759454 4:159263954-159263976 CAGGGTAGAAAGTTCTTACATGG + Intronic
986096402 5:4558449-4558471 CAGGCTAGAAAATTCTGAAATGG + Intergenic
988517833 5:31920016-31920038 CTGGCCAGAAAAAACTTAAAAGG - Intronic
989713668 5:44432513-44432535 CTGCCTATAAAAGTCATACATGG + Intergenic
990153291 5:52845227-52845249 CATGCTAGAAAAATCCTTCAGGG + Intronic
990559036 5:56965431-56965453 CTGGGTATAAAAATCTTGCAGGG + Intronic
991564969 5:67996026-67996048 GTGGCTAGACAAATCATCCAAGG - Intergenic
992462056 5:76970240-76970262 CCGGCTAGAAAATTCTTTTAAGG + Intronic
993574810 5:89587766-89587788 CATGCTAGAAAAAGCTTACGTGG - Intergenic
995036477 5:107539758-107539780 CCGGCCAGAAAACTCTTAAATGG + Intronic
996244214 5:121240539-121240561 ATGGCTAAAAAAAGCTGACATGG + Intergenic
997785397 5:136706884-136706906 CTGACTACAGAAATATTACAAGG + Intergenic
998766494 5:145493520-145493542 ATGGCTTTTAAAATCTTACATGG + Intronic
1003693548 6:8378720-8378742 CTAGCTAGTAGAGTCTTACATGG + Intergenic
1004658031 6:17683773-17683795 CTGGCTATCAAAATCCTAGATGG + Intronic
1005434359 6:25792473-25792495 CAGGCTAGAACAATTTTAAAGGG - Intronic
1006668394 6:35714149-35714171 CTGACTTGAAAAATCTTAGGCGG + Intronic
1010106734 6:72179213-72179235 CTGATTAGAAAAATGTTACCAGG - Intronic
1010685087 6:78845081-78845103 CTGGCTAGGAATTTCTGACAGGG - Intergenic
1010692620 6:78928519-78928541 CTGGCTAGAGCAATCAGACAAGG - Intronic
1011322224 6:86108102-86108124 ATGGCTAGAAATATCTTAGTTGG + Intergenic
1012003872 6:93688134-93688156 CTAGCTAGAGGAATCTGACAAGG + Intergenic
1012827868 6:104168529-104168551 CTGACTAGAAAAATATTAACTGG - Intergenic
1014810121 6:125875622-125875644 CTGGCTGGAAAAATCACAGAAGG - Intronic
1015433473 6:133157602-133157624 CTGGCTAGAAAAATGGTTAATGG + Intergenic
1017098009 6:150822209-150822231 CTGGCAATAAAAATTTTAAATGG + Intronic
1018357616 6:163034753-163034775 GTAGCCAGAAAAATGTTACAGGG + Intronic
1019801266 7:3090002-3090024 CTGGGAAGAAAAATCAGACATGG + Intergenic
1021827743 7:24572418-24572440 CTGGCTAGAAAAACATAGCAAGG - Intergenic
1022068372 7:26885059-26885081 CTGGGTACAAAATTCTTACATGG + Intronic
1023724506 7:43128230-43128252 CTAGCTATGAAAATCCTACATGG - Intronic
1025640211 7:63359990-63360012 CTGCCTTGAAGAATCTTACCAGG - Intergenic
1025642488 7:63388103-63388125 CTGCCTTGAAGAATCTTACCAGG + Intergenic
1026367551 7:69664160-69664182 CTCTCTATAAAAATCTTCCAGGG - Intronic
1026442449 7:70456214-70456236 ATGGCTATGTAAATCTTACATGG - Intronic
1028659083 7:93247376-93247398 CAGGATAGAAAAATGTCACAAGG - Intronic
1029201477 7:98842062-98842084 CTCTCTAGAAAACACTTACAGGG + Intergenic
1029941716 7:104487833-104487855 TTGTCTAGAAAAATATTACCAGG - Intronic
1030623216 7:111815219-111815241 AGGGCTAGAAAGATCTTAAAAGG + Intronic
1030827052 7:114170965-114170987 CTAGCTAGAAAATTCCTAGATGG - Intronic
1031129219 7:117811733-117811755 CTGGCTATAAAAAACCTATAGGG - Intronic
1031639525 7:124144504-124144526 TTGGCTAGAAAAAAATCACATGG + Intergenic
1032412362 7:131705826-131705848 CTCGTGAGATAAATCTTACATGG + Intergenic
1032856694 7:135840105-135840127 CTGATTTGAAAAATCATACATGG + Intergenic
1033437650 7:141348082-141348104 CTGGCTGATAAAATCTCACAAGG - Intronic
1033956517 7:146855987-146856009 CTAGTTAGAAAAATTTTACCAGG + Intronic
1036002297 8:4620975-4620997 TTGGCTAGAAAGATTTTAAAAGG + Intronic
1037362271 8:18085699-18085721 CTGCCTAGAATACTCTTACTTGG - Intergenic
1037956281 8:23062677-23062699 CTGGCTATAAATATCATAGATGG + Intronic
1040748603 8:50677369-50677391 CTGGTTAGTAAAATTTTATATGG + Intronic
1040841212 8:51786823-51786845 CTTGCTACAAAAGTCTTAGATGG - Intronic
1041548670 8:59076094-59076116 CAGGTTAGAAGAATCTTTCAAGG + Intronic
1041742624 8:61172945-61172967 CTGGCTAGAACTAAGTTACATGG + Intronic
1044507429 8:93038481-93038503 CTGCTTAGAAAAATCTTAGATGG - Intergenic
1045475329 8:102547703-102547725 CTGGCTAGTAGAATCATAGATGG - Intergenic
1045743614 8:105390153-105390175 CTGACAAGAACAATCTTACTGGG - Intronic
1048059431 8:130902656-130902678 CTGCCTAAAAAAATTTTAAATGG - Intronic
1050930441 9:11316535-11316557 GTGGCTTGAAAAATCTCTCAGGG - Intergenic
1051446314 9:17142884-17142906 GTGGTTAGGAAAATCTTACTAGG + Intronic
1051968067 9:22853826-22853848 CTAGCTATGAAAATCTTAGATGG + Intergenic
1052365334 9:27606309-27606331 CTGGCTTGAAGAATCTTTAAAGG + Intergenic
1053082361 9:35187166-35187188 TTGGCAAGTAAAATTTTACATGG - Intronic
1053225189 9:36348899-36348921 CTAGCTATGAAAATCTTAGATGG - Intronic
1056031082 9:82554055-82554077 CTGGCTAGAAGAATCTCAATAGG + Intergenic
1057846060 9:98525044-98525066 CTGACTATAAAATTCTTAGAAGG + Intronic
1057888435 9:98849366-98849388 CTTGATAGAAAAATATTATAAGG - Exonic
1058387298 9:104452962-104452984 CTGGCCAGATAGATCTTAAAAGG - Intergenic
1058599734 9:106656341-106656363 CTAGCTTGAAAAATCCTTCATGG - Intergenic
1059092948 9:111380620-111380642 CTAGCTAGGAAAATCCTACATGG + Intronic
1059572423 9:115453786-115453808 CTAGCTATAAAAGTCTTACATGG + Intergenic
1061655941 9:132090168-132090190 CTGGCCAGAACAATGTCACATGG + Intergenic
1186912991 X:14189610-14189632 CTGGCCAGAAAAATCAGACAAGG - Intergenic
1188235594 X:27727292-27727314 CTGGTTTTAAAAATCTTAAATGG + Intronic
1188456098 X:30367976-30367998 CTAGCTATGAAAATCTTAGATGG + Intergenic
1190051512 X:47153577-47153599 ATGGCTAATAAAATCTAACAAGG - Intronic
1193908639 X:87274874-87274896 GTTGCAAAAAAAATCTTACAGGG - Intergenic
1199054431 X:143276114-143276136 CTGGCTATGAAAATCCTAGATGG - Intergenic
1199281462 X:146004952-146004974 CTAGCTACAAAAATCCTAGATGG - Intergenic
1199881623 X:151978072-151978094 CAGCCCAGACAAATCTTACATGG + Intergenic
1201775830 Y:17664689-17664711 CTGGCTAGAACAATCAGGCAGGG - Intergenic
1201825726 Y:18241303-18241325 CTGGCTAGAACAATCAGGCAGGG + Intergenic