ID: 910163422

View in Genome Browser
Species Human (GRCh38)
Location 1:84298498-84298520
Sequence GGCCGCCACGCGCAAAGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910163422_910163424 -6 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163424 1:84298515-84298537 GCGGCCGCCGAGCTCCGCGCGGG 0: 1
1: 0
2: 2
3: 20
4: 209
910163422_910163430 12 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163430 1:84298533-84298555 GCGGGGCAAACCTCCCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 47
910163422_910163428 7 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163428 1:84298528-84298550 TCCGCGCGGGGCAAACCTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 28
910163422_910163425 -5 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163425 1:84298516-84298538 CGGCCGCCGAGCTCCGCGCGGGG 0: 1
1: 0
2: 0
3: 20
4: 143
910163422_910163436 25 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163436 1:84298546-84298568 CCCGGCGCGGCCATGCGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 199
910163422_910163434 22 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163434 1:84298543-84298565 CCTCCCGGCGCGGCCATGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
910163422_910163431 20 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163431 1:84298541-84298563 AACCTCCCGGCGCGGCCATGCGG 0: 1
1: 0
2: 0
3: 3
4: 56
910163422_910163432 21 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163432 1:84298542-84298564 ACCTCCCGGCGCGGCCATGCGGG 0: 1
1: 0
2: 0
3: 5
4: 72
910163422_910163423 -7 Left 910163422 1:84298498-84298520 CCGGGGCTTTGCGCGTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 910163423 1:84298514-84298536 GGCGGCCGCCGAGCTCCGCGCGG 0: 1
1: 0
2: 5
3: 24
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910163422 Original CRISPR GGCCGCCACGCGCAAAGCCC CGG (reversed) Exonic
900113657 1:1019894-1019916 CGCCGCCGCGAACAAAGCCCCGG - Intergenic
902193380 1:14779437-14779459 GGCCTGCACGTGCAAAGGCCGGG - Intronic
910163422 1:84298498-84298520 GGCCGCCACGCGCAAAGCCCCGG - Exonic
915322608 1:155063982-155064004 GGCGGGCGCGCGCAAAGCCCGGG - Intronic
915326140 1:155082136-155082158 CGCCACCACCCTCAAAGCCCGGG + Intronic
921432788 1:215082988-215083010 CGCCGCCACGCGCTCAGCCCCGG - Intronic
922573460 1:226646961-226646983 GGCCATCATGGGCAAAGCCCAGG + Intronic
923257242 1:232232527-232232549 GGCAGCCACTCCCAGAGCCCCGG - Intergenic
1067079463 10:43205026-43205048 GGCCCCCTCACCCAAAGCCCAGG + Intronic
1069024059 10:63521388-63521410 GGCCGCCGCGCGCACACACCGGG + Exonic
1074191697 10:111143677-111143699 GGCCTCCAAGTGCCAAGCCCTGG + Intergenic
1076793083 10:132786861-132786883 GGCCGCCTCTCGCGAATCCCCGG + Intergenic
1076916350 10:133424592-133424614 GGAGGCCTCGCGCAAAACCCAGG - Intergenic
1076936457 10:133569387-133569409 GGAGGCCTCGCGCAAAACCCAGG - Intronic
1077537267 11:3130394-3130416 GGCCCCCCCCAGCAAAGCCCAGG - Intronic
1078046095 11:7915486-7915508 GGCAGCCACTCCCAGAGCCCTGG - Intergenic
1085312675 11:75525636-75525658 GGCCGGGACGCGCGGAGCCCCGG - Exonic
1085503139 11:77040426-77040448 GGCGGCCGCGCGCAGGGCCCGGG - Exonic
1085527519 11:77172900-77172922 AGCCGCCACCCGCCAACCCCAGG - Intronic
1089557632 11:119323371-119323393 CGCGGCCACTGGCAAAGCCCGGG + Intergenic
1091562989 12:1629078-1629100 AGCCGCCTCGTGGAAAGCCCGGG + Intronic
1098630002 12:72712218-72712240 GGCAGCCACTCCCAGAGCCCTGG - Intergenic
1103402252 12:120650857-120650879 GACCGCCATGCCCAAAGCCTGGG - Intronic
1104089981 12:125508317-125508339 GTCAGCCACGAACAAAGCCCTGG + Intronic
1113657170 13:112074052-112074074 AAACGCCACGCGCAACGCCCGGG - Intergenic
1117174189 14:53130785-53130807 GGCAGCCACTCCCAGAGCCCTGG + Intronic
1117302223 14:54441137-54441159 ATCCCCGACGCGCAAAGCCCCGG + Intronic
1118768246 14:68924534-68924556 GGCCTGCAGGCTCAAAGCCCTGG + Intronic
1122205313 14:100145331-100145353 GGCCGCCCGGCTCAAAGTCCTGG + Exonic
1125589217 15:40844195-40844217 GGCCCCCGCGCGCAAGGCCGAGG + Intronic
1132684829 16:1157963-1157985 GGGCGCCACGGGCAAGGCACGGG - Intronic
1132723183 16:1327063-1327085 GGCTCCCACCCCCAAAGCCCAGG - Intergenic
1138501377 16:57447196-57447218 GGCCGCCCCGCTGAAAGCCCCGG - Intronic
1143431850 17:6893810-6893832 GCCCGCCAGGAGCAAATCCCCGG - Intronic
1146452235 17:32983736-32983758 GGCCGACAGGCTCAAAACCCAGG + Intronic
1146789558 17:35743620-35743642 GGCCCCCAGTCCCAAAGCCCAGG + Intronic
1148579371 17:48733209-48733231 GGCGGCCGCGCTCAAAGGCCGGG - Intergenic
1150840404 17:68601077-68601099 GGCCGCCGGCTGCAAAGCCCGGG + Exonic
1152088173 17:78232550-78232572 GGCTGCCAGGCCCAAACCCCGGG - Intronic
1152614524 17:81331643-81331665 GGCCGCCCCCGGCAAAGCCAGGG + Intergenic
1160141140 18:76324328-76324350 GACAGCCTCGCGCCAAGCCCAGG + Intergenic
1160702187 19:512966-512988 GGCCGCCTCGCGTCGAGCCCCGG + Intronic
1163666413 19:18606048-18606070 GGCCGCCTGGCGCGCAGCCCGGG - Intronic
1166126304 19:40717179-40717201 GGCCGCCGCGGGCAGCGCCCCGG - Exonic
1168503197 19:56910650-56910672 CGCCGCCAGGCACAAAGCGCTGG + Intergenic
931811155 2:65856375-65856397 GGCAGCCAGGCACATAGCCCTGG - Intergenic
933139774 2:78779011-78779033 GAGCGCCGCGCGCACAGCCCCGG - Intergenic
933741809 2:85539533-85539555 GGCGGCCACGCGCCAGGCCCTGG - Intronic
935046630 2:99489504-99489526 GGCCGCCCCGCGCCGACCCCTGG - Intronic
938328316 2:130428840-130428862 GGCCGCCACCGCCACAGCCCTGG + Intergenic
938361631 2:130692654-130692676 GGCCGCCACCGCCACAGCCCTGG - Intergenic
945251358 2:207768646-207768668 GGCCGCCGCGTCCAAGGCCCCGG - Exonic
947818153 2:233051842-233051864 GGCCACCACGCCCCAGGCCCCGG - Intergenic
948279189 2:236733406-236733428 GGCCTCCACGCCCAAAAGCCTGG - Intergenic
948513491 2:238488509-238488531 GGCCGCCTCTCAGAAAGCCCTGG + Intergenic
1171010172 20:21505373-21505395 CGCCGCCCCGCGGAAAGCCTGGG + Intergenic
1175487017 20:59353903-59353925 GGCTGCCAGGCGCAGAGCCTGGG - Intergenic
1175895371 20:62333579-62333601 GGCCTCCACACGCAGGGCCCAGG + Exonic
1182421477 22:30250732-30250754 AGCCGCCCCCTGCAAAGCCCCGG + Intergenic
1184750790 22:46485350-46485372 GGGCGCCACTCACAAAGGCCTGG - Intronic
954887760 3:53891646-53891668 GGCCGCGGGGCGCTAAGCCCGGG + Intronic
968671901 4:1856411-1856433 GGCCGCCACGCTGCGAGCCCCGG - Intergenic
969357772 4:6640645-6640667 GGCCGCAACGCGCAGAGCGCTGG + Exonic
971107609 4:23543772-23543794 GGCAGCCACAGGCAAAGGCCAGG + Intergenic
999202325 5:149825158-149825180 GGCCCCCACGCCCAGAGGCCTGG - Intronic
1013843652 6:114425648-114425670 GGCAGCCACTCCCAGAGCCCCGG - Intergenic
1019349349 7:546596-546618 GCCCGCCTCTCCCAAAGCCCTGG + Intergenic
1019980221 7:4615909-4615931 TGCAGCCACGCGCCAAGGCCAGG - Intergenic
1022164020 7:27740293-27740315 GGCCGCCCCGCACAAGGCGCTGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1034494059 7:151409788-151409810 GGCCGCCCCCCGCAGCGCCCTGG - Intronic
1049182576 8:141230585-141230607 GGCCGCCAGGAGCAGCGCCCAGG + Intronic
1049212279 8:141392239-141392261 GGCCGCCAGGCGCAGGGTCCCGG - Intronic
1049337855 8:142096045-142096067 GGCCGCCACACGCCAGGCACTGG + Intergenic
1049585220 8:143429881-143429903 CGCCGCCGCCCGCGAAGCCCGGG + Exonic