ID: 910168118

View in Genome Browser
Species Human (GRCh38)
Location 1:84349059-84349081
Sequence AAGTATCAGGAGAAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910168111_910168118 8 Left 910168111 1:84349028-84349050 CCCCATCGGACCATCTAAAAAAC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG No data
910168113_910168118 6 Left 910168113 1:84349030-84349052 CCATCGGACCATCTAAAAAACAT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG No data
910168114_910168118 -2 Left 910168114 1:84349038-84349060 CCATCTAAAAAACATATATTTAA 0: 1
1: 0
2: 18
3: 231
4: 2390
Right 910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG No data
910168108_910168118 30 Left 910168108 1:84349006-84349028 CCAGGAAACCTAAGACTCTAGTC No data
Right 910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG No data
910168109_910168118 22 Left 910168109 1:84349014-84349036 CCTAAGACTCTAGTCCCCATCGG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG No data
910168112_910168118 7 Left 910168112 1:84349029-84349051 CCCATCGGACCATCTAAAAAACA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910168118 Original CRISPR AAGTATCAGGAGAAGCAGAG GGG Intronic
No off target data available for this crispr