ID: 910168627

View in Genome Browser
Species Human (GRCh38)
Location 1:84354393-84354415
Sequence CCCTGAAGACAGTTGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910168627_910168633 5 Left 910168627 1:84354393-84354415 CCTGTCCACAACTGTCTTCAGGG 0: 1
1: 0
2: 2
3: 12
4: 126
Right 910168633 1:84354421-84354443 TCAAGAAAGCTGGGGATGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 265
910168627_910168631 -4 Left 910168627 1:84354393-84354415 CCTGTCCACAACTGTCTTCAGGG 0: 1
1: 0
2: 2
3: 12
4: 126
Right 910168631 1:84354412-84354434 AGGGAGAAATCAAGAAAGCTGGG 0: 1
1: 0
2: 6
3: 44
4: 578
910168627_910168630 -5 Left 910168627 1:84354393-84354415 CCTGTCCACAACTGTCTTCAGGG 0: 1
1: 0
2: 2
3: 12
4: 126
Right 910168630 1:84354411-84354433 CAGGGAGAAATCAAGAAAGCTGG 0: 1
1: 0
2: 2
3: 56
4: 512
910168627_910168632 -3 Left 910168627 1:84354393-84354415 CCTGTCCACAACTGTCTTCAGGG 0: 1
1: 0
2: 2
3: 12
4: 126
Right 910168632 1:84354413-84354435 GGGAGAAATCAAGAAAGCTGGGG 0: 1
1: 0
2: 2
3: 41
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910168627 Original CRISPR CCCTGAAGACAGTTGTGGAC AGG (reversed) Intronic
901631021 1:10648174-10648196 CAGTGAAGACAGGTGTGGAGGGG + Intronic
902083148 1:13835170-13835192 CCAGGAGGACACTTGTGGACTGG + Intergenic
902515725 1:16988473-16988495 ACCTGAAGAGAGGTGTGGACAGG + Exonic
905037087 1:34925388-34925410 CCCTGCAGACAGATGTGGTGGGG + Intronic
905091814 1:35436184-35436206 CCCTTAAGTCAGGTGTGGCCAGG - Intronic
908255714 1:62301967-62301989 CCCTGAAGACAGTCATGCATGGG + Intronic
910168627 1:84354393-84354415 CCCTGAAGACAGTTGTGGACAGG - Intronic
911978950 1:104541633-104541655 CTCTGGAGACTGTTGTGGAGTGG - Intergenic
913645098 1:120847881-120847903 CCTTGAAGACAGGTTTGGCCAGG + Intergenic
914081628 1:144415661-144415683 CCTTGAAGACAGGTTTGGCCAGG - Intergenic
914099473 1:144571177-144571199 CCTTGAAGACAGGTTTGGCCAGG + Intergenic
914176536 1:145284204-145284226 CCTTGAAGACAGGTTTGGCCAGG - Intergenic
914299512 1:146366500-146366522 CCTTGAAGACAGGTTTGGCCAGG - Intergenic
914531264 1:148525683-148525705 CCTTGAAGACAGGTTTGGCCAGG - Intergenic
914637127 1:149562057-149562079 CCTTGAAGACAGGTTTGGCCAGG + Intergenic
915630972 1:157154153-157154175 CCCTGGAGTGAGTTGTGGAGAGG + Intergenic
919457274 1:197835108-197835130 CACTGAAGACTGTTGTGGGGTGG + Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1068923895 10:62514764-62514786 CGATGAAGACAGTAGTGTACTGG - Intronic
1069960509 10:72076257-72076279 CCCTGAGGCCAGGTGTGGGCTGG + Intronic
1072107222 10:92285811-92285833 CACTGGAAACTGTTGTGGACTGG - Intronic
1074123793 10:110512483-110512505 CTCTGAACACAGTTGGGGAAAGG - Intergenic
1074820741 10:117176313-117176335 CCCTCAAGACAGTTATTTACAGG + Intergenic
1075520953 10:123143216-123143238 ACCTGAAAACAGTTGGGGGCTGG + Intergenic
1076149847 10:128153217-128153239 CCCTGGACACAGTTGAGGACTGG - Intergenic
1076637220 10:131889956-131889978 CCCTGAACCCAGTTGTAGAATGG - Intergenic
1082123771 11:48408293-48408315 CACTGGGGACAGTTGTGGAGTGG + Intergenic
1084967290 11:72751413-72751435 CCTTGAAGACAGGTGTGGACAGG - Intronic
1088958275 11:114633620-114633642 CTCTGGGGACAGTTGTGGGCTGG - Intergenic
1089168278 11:116494565-116494587 TCCTGAAGAGAGTTGTGGATGGG + Intergenic
1100161358 12:91864744-91864766 CCCTGAAGACAGATGTGTCCTGG + Intergenic
1104850785 12:131872559-131872581 GCCTGAAGACAGTGGGAGACAGG - Intergenic
1105532151 13:21229907-21229929 CCCTCAGGACAGTTGAGGCCTGG - Intergenic
1107555446 13:41513563-41513585 CCCACAAGACAGCTGAGGACAGG - Intergenic
1107698390 13:43023035-43023057 CACAGAAGAAAGTTGTGGCCGGG - Intergenic
1109174674 13:59140535-59140557 ACCTGCAGACAGTGGGGGACAGG + Intergenic
1110454379 13:75673579-75673601 CCCTGAGGACATTTTGGGACTGG + Intronic
1110678781 13:78283334-78283356 CTCTGAGGACTGTTGTGGAGGGG - Intergenic
1112391492 13:98988963-98988985 CCCTGAAGACAGTGGCTGAAGGG - Intronic
1118769075 14:68929599-68929621 CCCTGAAGCCATTTCTGGAACGG - Intronic
1119799419 14:77429650-77429672 TCCTGAAGAGAGTTGGGTACAGG - Intronic
1120358562 14:83464913-83464935 CCCTGAGGCCAGTTGTTAACGGG - Intergenic
1121526279 14:94621620-94621642 CCCTCAAGCCAGGTGTGGGCTGG - Intronic
1202877183 14_KI270722v1_random:14446-14468 CACTGAGGACAGTTGTGGAGTGG + Intergenic
1124135742 15:27034862-27034884 AACTGAAGACAGTAGTGTACAGG - Intronic
1125992743 15:44125858-44125880 CCCTGAAGTCAGTGGTGGCAGGG - Intronic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1132431321 15:101764426-101764448 ACCTGCAGACACTTGTGGAGGGG + Intergenic
1135421330 16:22307515-22307537 CTGTGAGGACAGATGTGGACAGG + Intronic
1136185644 16:28587329-28587351 CACAGAAGACAGTTTAGGACAGG + Intronic
1137584941 16:49658714-49658736 CCCTGAAGGCAGCTGTGGCAGGG + Intronic
1137591113 16:49694553-49694575 CCCTGAAGGCAGCTGAGCACAGG - Intronic
1137813819 16:51379142-51379164 ACCTGTAGAAAGGTGTGGACGGG + Intergenic
1137869085 16:51932226-51932248 CCCTGGAGACAGTGGTGTTCAGG - Intergenic
1137946074 16:52734395-52734417 CCCTGAGGCCAGGGGTGGACTGG + Intergenic
1139751755 16:69113188-69113210 CCCTGAAGACAGTAGGTGCCAGG - Intronic
1140812444 16:78591394-78591416 CACTGGAGACAGTTGTGTACTGG - Intronic
1146321794 17:31852728-31852750 CCCTGAAGGCAGTTTGGAACAGG - Intronic
1151963176 17:77418167-77418189 GCCTGGACACAGGTGTGGACAGG + Intronic
1152799409 17:82323910-82323932 CCCTGAAGACAGGAGTGGCGAGG + Intronic
1153358842 18:4170437-4170459 CCCTGAAGACAGGTGAGAATGGG + Intronic
1155247022 18:23920330-23920352 CCCTGAAGACAGGTCTAGGCTGG + Intronic
1159865020 18:73693253-73693275 CCTTGAAGATATTTATGGACTGG + Intergenic
1160977917 19:1802807-1802829 CCCTGAGGCCAGGTGGGGACAGG - Intronic
1162514264 19:11138727-11138749 CACTGCAGACAGCTGTGGTCTGG - Intronic
1162648023 19:12064306-12064328 CCCAGAAGACAGTTGTGCAAGGG + Intergenic
1162743483 19:12786421-12786443 CCCCGAAGACACTTGTGGGTGGG + Intronic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1167395185 19:49223802-49223824 CCCTGCACCCAGCTGTGGACTGG - Intergenic
1167791573 19:51686455-51686477 CCCTGTAGACAGATCAGGACAGG - Intergenic
1202673496 1_KI270710v1_random:18486-18508 CACTGAGGACAGTTGTGGAGTGG - Intergenic
925324805 2:3010046-3010068 CCCTGAAGACGGTCTTGGGCAGG + Intergenic
927790194 2:26003516-26003538 CCCTGGAGTCAGATGTGGAAAGG - Intergenic
928126409 2:28619735-28619757 CCCTGAAGATTTGTGTGGACTGG + Intronic
936686992 2:114838876-114838898 CCATGAAGACAGATGAGGAGAGG - Intronic
938230491 2:129654787-129654809 CCCTGTGGACACTTGCGGACAGG - Intergenic
943703910 2:191014883-191014905 CCCAGAGGAGAGGTGTGGACGGG - Intronic
944341757 2:198609747-198609769 CCCTGAAAAGAGTTTTGGAAGGG - Intergenic
945113976 2:206392836-206392858 CACTGTAGACAATTTTGGACTGG + Intergenic
945921541 2:215760293-215760315 CCCTGCAGACATTTCTGGACAGG + Intergenic
1175258868 20:57662772-57662794 CCCTGGAGACAGCTGGGGAAGGG - Intronic
1176689288 21:9883636-9883658 CCCTGAAGGCAGTTGGGTAGTGG + Intergenic
1181077915 22:20393774-20393796 TCCTGCAGACAGATGTGGGCAGG + Intergenic
1181273312 22:21673412-21673434 CCATGAGGGCAGCTGTGGACAGG - Intronic
1181830322 22:25555350-25555372 CCGGGATGACAGTGGTGGACAGG - Intergenic
1183519849 22:38290563-38290585 CCCTGAAGGCAGGTGTGGCTGGG - Intergenic
1184394753 22:44226648-44226670 CCCTGAACACAGTCTTGGAGAGG + Intergenic
951925865 3:27908236-27908258 CCCTGAAGGCAGTAGTGGGCTGG + Intergenic
952341454 3:32451043-32451065 CAGTGCAGACAGTTGGGGACCGG + Intronic
952772789 3:37017461-37017483 CCCTCAGGACAGTTTTGAACTGG + Intronic
953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG + Intergenic
956675966 3:71732077-71732099 CCCAGAAGACAGTGGTGGAGGGG - Intronic
960671808 3:120161638-120161660 CCCTTAAGACAGTTCTGGTGAGG + Intergenic
963221390 3:142816813-142816835 CCCTGATGACAGTGGGTGACTGG - Intronic
964626209 3:158762544-158762566 CCCTGCTGTCAATTGTGGACAGG + Intronic
966999342 3:185317171-185317193 CCCTGAAAACAGCTTTGGAGAGG + Intronic
969631477 4:8341160-8341182 GCCTGAAGACAGATGGGGCCTGG - Intergenic
970101172 4:12524329-12524351 CCCTGCAAACAGGTGTGGCCAGG - Intergenic
970648820 4:18155452-18155474 CACTGAATTCAGTTGTTGACTGG - Intergenic
980352674 4:131701451-131701473 CCCTGAAGGCAGTTGGGTAGTGG + Intergenic
983601504 4:169534674-169534696 CACTGAAGACTGTTCTGTACTGG + Intronic
984875471 4:184363928-184363950 CCCTCACGACTGTGGTGGACTGG - Intergenic
992085024 5:73270508-73270530 TCCTGTAGACAGTTGGGTACAGG - Intergenic
993554140 5:89314604-89314626 CTCTGAAGACAATTCTGGTCTGG - Intergenic
996331964 5:122339864-122339886 CCCTGAAGACAGACTTGGAAGGG - Intronic
997854762 5:137363491-137363513 ACCTGAAGACAGACCTGGACTGG + Intronic
1002892459 6:1347363-1347385 CCCTGAAGACATTAGGGGACTGG - Intergenic
1006820408 6:36889030-36889052 CCCTAGAGAGAGTTGTAGACTGG + Intronic
1008719402 6:54330092-54330114 ACTTGAACTCAGTTGTGGACCGG + Intronic
1009341447 6:62559561-62559583 CTCTGAAGACTGTTGTGGGGTGG + Intergenic
1010362217 6:75008188-75008210 CTCTGAGGACTGTTGTGGGCTGG + Intergenic
1011424136 6:87207855-87207877 CCAAGAAGACAGTTGTGCAATGG - Intronic
1013354827 6:109337428-109337450 ACCTGAAGACAGTGCTGGCCAGG + Intergenic
1015294589 6:131576141-131576163 CCCTTAACACTGTTGGGGACAGG - Intronic
1017269368 6:152488868-152488890 CCCAGAAGACAGTTCTAGATGGG + Intronic
1020218518 7:6215288-6215310 CCCTAAAGACAAATGAGGACAGG + Intronic
1027165067 7:75828489-75828511 CACTGAAAACAGTTGTGTGCAGG + Intergenic
1028284573 7:88980760-88980782 ACCTGAAGACAGTTCAGCACTGG + Intronic
1035839902 8:2800047-2800069 CTCTGATGACAGTTGTGGGATGG - Intergenic
1037653917 8:20866725-20866747 CCCTGAAGACAGCCCTGGAGAGG - Intergenic
1038248294 8:25879607-25879629 CCCTGAAGTCAGTTGGAGAGTGG - Intronic
1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG + Intergenic
1041616138 8:59908195-59908217 CCCTGAAGACAGCACAGGACTGG - Intergenic
1048045545 8:130769089-130769111 CCCTGAAGATAGATGGGGAAGGG + Intergenic
1049370008 8:142259887-142259909 CCCTGAAGGCTGTTGTGGCGAGG + Intronic
1052248526 9:26368749-26368771 CCCTGATGGCAGTTGTAGTCTGG - Intergenic
1052725265 9:32221478-32221500 CCCGGAAGAAAGATGTGGGCTGG + Intergenic
1053894277 9:42727610-42727632 GCCTGAAGACATATGTGGCCTGG + Intergenic
1056760869 9:89414224-89414246 CTCTGGTGACAGCTGTGGACTGG + Intronic
1057505680 9:95631596-95631618 CACTGAAGACCGTGATGGACTGG + Intergenic
1058117515 9:101101216-101101238 CTCTGAAGAAACATGTGGACTGG + Intronic
1059533565 9:115060158-115060180 TCCTGAAGACAACTGTGGCCAGG - Intronic
1059561073 9:115334943-115334965 CCCAGAAGCCACTTGGGGACAGG + Intronic
1061991102 9:134159215-134159237 CCATGGAGACAGTTGTGGTGAGG + Exonic
1187564949 X:20440139-20440161 AACTGAAGGCAGTTGTGTACTGG - Intergenic
1187638764 X:21263363-21263385 CTCTGAGGACTGTTGTGGAGTGG - Intergenic
1188965387 X:36545268-36545290 ACCTGAAGACAGGTGAGAACAGG + Intergenic
1193056643 X:77159587-77159609 CCCTGAAGTCATTGGTGGCCAGG - Intergenic
1197615523 X:128686301-128686323 CTCTGGAGACAGTTGTGGGGTGG - Intergenic
1197750636 X:129961400-129961422 CCCTGAGGACAGTTGGGGCGGGG - Intergenic
1199093325 X:143715103-143715125 ACCTGAAGACAGGTGGGGCCTGG + Intronic