ID: 910169409

View in Genome Browser
Species Human (GRCh38)
Location 1:84361454-84361476
Sequence TACCCTGTGCTGTGAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910169405_910169409 16 Left 910169405 1:84361415-84361437 CCAAAGGCATTCTAGCTCTAATC No data
Right 910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG 0: 1
1: 0
2: 2
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910169409 Original CRISPR TACCCTGTGCTGTGAGGTAG GGG Intronic
900431048 1:2603399-2603421 CGCCCTGTGCTTTGAGGTGGGGG - Intronic
900930691 1:5735151-5735173 TTGCCTGTGCTGTGAGTTGGAGG - Intergenic
902572117 1:17353569-17353591 TACCCTCTCCTGGGAGGCAGGGG + Intronic
906935616 1:50211736-50211758 TAACCTGGTCTGAGAGGTAGAGG - Intergenic
907507155 1:54927910-54927932 GACCCTGTGCTGGGAACTAGGGG + Intergenic
910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG + Intronic
911870432 1:103090236-103090258 TAGTCTGTGATGTGAGGTATGGG - Intronic
912065872 1:105741861-105741883 TAACCTGAGCTGGGAGGTTGAGG + Intergenic
913145708 1:115987906-115987928 TACCTTGTGCTGTGAAGTCATGG - Intronic
918751225 1:188272261-188272283 TACCCCGGGCTGGGAGGTAGGGG - Intergenic
919553999 1:199029074-199029096 TTCCTTGGCCTGTGAGGTAGGGG - Intergenic
922752902 1:228079207-228079229 CACCCTGAGCTGGGAGGTGGGGG + Intergenic
922781497 1:228256515-228256537 TTCCTTGTGCTGGGAGGTGGTGG + Intronic
922782452 1:228263946-228263968 TTCCTTGTGCTGGGAGGTGGTGG + Intronic
924383301 1:243482670-243482692 TACGCTGTGCTGTGAGGGCCGGG + Intronic
924512242 1:244737287-244737309 GAACCTCTGCTGTGAGGCAGAGG - Intergenic
1067047323 10:42991919-42991941 TACCCAGAGCTGTGGGGTGGAGG + Intergenic
1067146468 10:43697645-43697667 TCCCCAGGGCTGTGAGGTATGGG - Intergenic
1067713462 10:48668586-48668608 TACTCTCTTATGTGAGGTAGTGG + Intergenic
1067947320 10:50697962-50697984 TCCCCTCCGCTGTGAGGAAGTGG + Intergenic
1070882632 10:79862947-79862969 TCCCCTCCGCTGTGAGGAAGTGG + Intergenic
1071375723 10:85000795-85000817 TATCCTGTGCTGGAAGGTGGAGG + Intergenic
1071649199 10:87379249-87379271 TCCCCTCCGCTGTGAGGAAGTGG + Intergenic
1071737438 10:88317873-88317895 AACCCTGTGCTAAGGGGTAGTGG + Intronic
1071977911 10:90973686-90973708 TTCTGGGTGCTGTGAGGTAGGGG + Intergenic
1075811692 10:125228810-125228832 TACCCTGTGCCTGCAGGTAGCGG - Intergenic
1077461093 11:2710649-2710671 TAACATATGGTGTGAGGTAGGGG + Intronic
1081350876 11:42050986-42051008 TATCCTGTTCTGTGCCGTAGAGG - Intergenic
1082857733 11:57824072-57824094 TACCCAGTGCTGTGATATAAAGG - Intergenic
1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG + Intronic
1083600324 11:63943300-63943322 TACCCTCTGCACTGAGGCAGAGG - Intronic
1083924125 11:65795709-65795731 TGCCCTGTGCTGAGAGGCGGGGG - Exonic
1085014896 11:73167516-73167538 TACCCTGTGCAGTGAGCTCAGGG + Intergenic
1085829611 11:79885420-79885442 TACCCTGGGCTATGAGCTTGGGG - Intergenic
1087179972 11:95132058-95132080 TACGCTGGGCTTTGAGGTAGAGG + Exonic
1087852777 11:103051716-103051738 TTTCCTCTTCTGTGAGGTAGAGG - Intergenic
1088403450 11:109445969-109445991 TACCATGTGTGGTGAGATAGGGG + Intergenic
1100439557 12:94603605-94603627 TACCCTTTGCGGGGAAGTAGGGG + Intronic
1100873737 12:98940350-98940372 TGGCCTGTGCTGTGAGGAGGGGG + Intronic
1101453499 12:104805235-104805257 CACCCAATGCTGTTAGGTAGGGG + Exonic
1102207634 12:111101259-111101281 TGCCCTGAGCTGTGTGGTAAGGG + Intronic
1106593563 13:31118290-31118312 CTCCCTGTGCTGTGATGTGGTGG + Intergenic
1108057449 13:46498833-46498855 TACTCAGTGCAGTGAGGCAGAGG + Intergenic
1115670130 14:35601440-35601462 TGACCTTTGCTGTGAGGTTGGGG + Intronic
1121119010 14:91364235-91364257 TACCATGTGCTCTGCGGAAGGGG - Intronic
1123039472 14:105484517-105484539 TACCCTGTGCTCTGGGGGTGGGG - Intergenic
1124129375 15:26971168-26971190 TGCGCTGTGCTGGGAGGTGGGGG - Intergenic
1128659142 15:69485060-69485082 CACCCAGTGGTGTGAGGGAGTGG - Intergenic
1129955004 15:79628232-79628254 TACCCTGTCCTGTGAGGCACAGG + Intergenic
1130417293 15:83705680-83705702 TCCCCTGAGCTGGGAGATAGAGG - Intronic
1132303403 15:100790215-100790237 CACCCGGTGATGTGAGGCAGGGG - Intergenic
1135326858 16:21531750-21531772 TTGTGTGTGCTGTGAGGTAGGGG + Intergenic
1136337115 16:29617164-29617186 TTGTGTGTGCTGTGAGGTAGGGG + Intergenic
1140456214 16:75107127-75107149 CACCCAGTGCTGTGGGATAGAGG - Intronic
1141120816 16:81354476-81354498 AACCCTGTGCTGTGAGTTTTTGG + Exonic
1142039909 16:87886494-87886516 TTGTGTGTGCTGTGAGGTAGGGG + Exonic
1142183598 16:88684004-88684026 TAACCAGTGCTGTGAGGATGAGG + Intronic
1142190201 16:88713924-88713946 CACCCTGTGCCGTGAGGGTGTGG + Intronic
1142756494 17:2019348-2019370 TACCATCTGCAGTGAAGTAGTGG - Intronic
1143390188 17:6555734-6555756 TAGCCTGTGGTTTGAGGGAGCGG - Intronic
1143395549 17:6592637-6592659 TTGCCTGTGATTTGAGGTAGAGG - Intronic
1145807852 17:27747170-27747192 TTCCTGGTGCTGGGAGGTAGGGG - Intergenic
1146447551 17:32944426-32944448 TAGCCAGTGCTGTGATGGAGGGG + Intronic
1147244089 17:39109199-39109221 TTCCCTGTGCTGGGAGGCCGGGG - Intronic
1151233163 17:72699400-72699422 TAGACTTTGCTGGGAGGTAGGGG + Intronic
1151589848 17:75035966-75035988 TACTCTGTGCTTGGAGGAAGAGG + Intronic
1151977929 17:77492849-77492871 TACCCAGTGCTGTCAGGCTGAGG + Intronic
1152793556 17:82295059-82295081 TACCAAGTGCTGTGAGGATGTGG - Intergenic
1157508548 18:48250401-48250423 CACATAGTGCTGTGAGGTAGGGG - Intronic
1159624988 18:70682205-70682227 TTGCCTGTGGTGTGAGGTAAGGG - Intergenic
1160666172 19:329940-329962 TTCCATGTGCTGTGAGGGCGTGG + Intronic
1166896512 19:46025882-46025904 TTGCATGTGGTGTGAGGTAGGGG + Intergenic
927199821 2:20571334-20571356 CAGGCTGTGCTGTGAGGGAGGGG - Intronic
928626416 2:33144088-33144110 TCTCGTGTGCTGTGGGGTAGAGG + Intronic
929093545 2:38242916-38242938 TACCCTGTGCTGTGAGATCCTGG - Intergenic
929103296 2:38338649-38338671 TTCCCTGTTCTTTGAGGTTGGGG + Intronic
929167235 2:38894774-38894796 TACACTTAGCTGTGAGGAAGAGG + Intronic
929243214 2:39673949-39673971 TACCCAGAGCAGTGAGGAAGGGG + Intronic
929922637 2:46183541-46183563 TGCTCTGTGCTGTGGGGGAGAGG + Intronic
931534154 2:63253735-63253757 TAACATATGCTGTGAGGTTGTGG + Intronic
932183126 2:69667570-69667592 TATCCTGTGATGTGATGTATGGG + Intronic
935059612 2:99596002-99596024 TTCCCTGGGCTGTGAGGATGCGG + Intronic
935355411 2:102194558-102194580 TACCATGTGTTGTCAGGTATAGG - Intronic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
937468852 2:122158176-122158198 TAGCCTGTGCTGTGAGCAGGAGG + Intergenic
938564870 2:132509674-132509696 TAGCCAGTTCTGTGAGGCAGGGG - Intronic
939235213 2:139483050-139483072 TTATCTGTGGTGTGAGGTAGAGG + Intergenic
941752401 2:169147009-169147031 TGCCCTGTGCTCTGCTGTAGTGG - Intronic
946875629 2:224126779-224126801 TAGCCTGTTCTGTGAGGAGGTGG - Intergenic
947987621 2:234462584-234462606 AACCCTGGGCAGTGGGGTAGGGG - Intergenic
1169600239 20:7250818-7250840 TGCCTTCTGCTGTGAGGGAGAGG - Intergenic
1172869126 20:38124960-38124982 TACCCTTTTCTGGGAGATAGGGG - Intronic
1175543401 20:59762318-59762340 TACCCTGTGCCTTAAGGCAGTGG + Intronic
1177229067 21:18295804-18295826 CACCCTGTGGTGGGAGGTGGTGG + Intronic
1178008602 21:28255012-28255034 TACCCTATTCTTGGAGGTAGAGG - Intergenic
1179009550 21:37545824-37545846 TACACTTTCCTTTGAGGTAGGGG + Intergenic
1180719893 22:17900235-17900257 TGCCCTGTGCTGTGATGCTGAGG - Intronic
1183031449 22:35109378-35109400 GACACTGTGCTGTGAGCTGGAGG - Intergenic
1183418032 22:37693858-37693880 CACCTTGTGCTGTGAGGCAGGGG - Intronic
1183756724 22:39773965-39773987 CACAATGTGCTGTGTGGTAGTGG + Intronic
1183908273 22:41059455-41059477 TACCTGGGACTGTGAGGTAGGGG - Intergenic
1185019173 22:48363698-48363720 TATCCAGTGCTGTGAGGGAATGG - Intergenic
1185347216 22:50315833-50315855 TCCCCTGTGCTGTGAGGCAGGGG - Intronic
949343032 3:3050012-3050034 CACCCAGTGCTGGGAGGGAGAGG + Intronic
949913300 3:8934113-8934135 TAGCATATGTTGTGAGGTAGAGG - Intronic
951083627 3:18483330-18483352 TACACTGTGTTATGAGGTAAAGG - Intergenic
952082844 3:29781820-29781842 TACCGTGGGCTGTGTGGGAGAGG + Intronic
952891927 3:38048867-38048889 TACACTGTGCTGTGGTGGAGGGG - Intronic
955045544 3:55356367-55356389 TAATCTATGCTGTGTGGTAGTGG - Intergenic
955331151 3:58048519-58048541 GAGCCTGTGCTGTGAGGCAGTGG - Intronic
955392172 3:58529893-58529915 TATTCTGTGCTGTGGGGTGGAGG + Intronic
955927996 3:64026559-64026581 CACCTTGTGCTTTGAGGAAGTGG - Intergenic
960699701 3:120428049-120428071 TACACTGTCTTCTGAGGTAGAGG + Intronic
960973694 3:123156474-123156496 TACCCTGTGCTGTGCACAAGTGG - Intronic
961139151 3:124541011-124541033 CAGCCTGTTCTGTGAGGGAGTGG + Intronic
961350716 3:126300325-126300347 CAGCCTGAGCTGTGAGGTGGTGG - Intergenic
962745757 3:138396383-138396405 TCCCCTCTCCTGTGAGGCAGGGG - Intronic
965691123 3:171357980-171358002 TACTCTGTGGAGGGAGGTAGAGG + Intronic
966497642 3:180599327-180599349 TTCTCTGTGAAGTGAGGTAGTGG - Intergenic
967109087 3:186277483-186277505 AACCCTGGCTTGTGAGGTAGAGG - Intronic
968469568 4:773170-773192 TGCCCTGTGCTGTGGGGCAGAGG - Intergenic
969437971 4:7199497-7199519 TTGCCTGTGCTGTGAAGCAGGGG + Intronic
979919623 4:126480346-126480368 TAACCTGGGCTGTGAGGGATAGG - Intergenic
982792099 4:159604997-159605019 TACCCTGTGAGGAGGGGTAGAGG - Intergenic
985654837 5:1125094-1125116 AACCCTGTGGTGTGGAGTAGGGG - Intergenic
986240618 5:5956507-5956529 CACTCTGTGCTGGGAGCTAGAGG + Intergenic
989210439 5:38853977-38853999 AACCCTATGCTGTAAGGCAGAGG + Intronic
1001006793 5:168059119-168059141 TAGCCTGTGCTGGCTGGTAGTGG + Intronic
1001065872 5:168534759-168534781 TGCCCTGTGCTGGGAGCTGGGGG + Intergenic
1002065060 5:176647724-176647746 TGCCCTGTGCTGGGGGGTGGTGG + Intronic
1002570790 5:180138223-180138245 AAGGCTGTGCTGTGAGGAAGGGG - Exonic
1002629684 5:180563133-180563155 CACCCTGTGCTGTGAGGCAGTGG - Intronic
1003591662 6:7441552-7441574 GACTCTGTGCTGTGAAGTAGGGG - Intergenic
1007452682 6:41952114-41952136 ACACCTGTACTGTGAGGTAGAGG + Intronic
1008344048 6:50404387-50404409 TACCGTGTACTGGGAGGTACAGG + Intergenic
1008563817 6:52748223-52748245 TCCCCTGTACTGTGAGCTCGTGG - Intergenic
1008572707 6:52830530-52830552 TCCCCTGTACTGTGAGCTGGTGG - Intergenic
1012521430 6:100126048-100126070 TACACTGTGGTGGGAGGCAGAGG + Intergenic
1014902298 6:126982501-126982523 TTGCATGTGGTGTGAGGTAGGGG - Intergenic
1015849823 6:137560315-137560337 GACTCTGTGCTGTTAGGTGGGGG - Intergenic
1019328241 7:450155-450177 CCCCCTGTGCTGTGAGGGTGTGG - Intergenic
1020791071 7:12628691-12628713 TTCCCTGTGCTTTAAGATAGCGG - Intronic
1023809158 7:43898137-43898159 TACACTGTGGTGTCAGGTGGAGG - Intronic
1024421147 7:49168071-49168093 TAACCTGTGCTGCTAGGTATAGG - Intergenic
1026326362 7:69314171-69314193 TACCTTGTGCTGTGAGACAGGGG - Intergenic
1029263137 7:99317534-99317556 TACCTTGGTCTGAGAGGTAGAGG + Intergenic
1031388150 7:121178431-121178453 AACTCTGTGCTGTAATGTAGAGG + Intronic
1032745661 7:134783574-134783596 TGACCTGGGCTGTGAGGGAGGGG + Intronic
1033294432 7:140117939-140117961 TGCACTATGCTGTGAGGTGGGGG + Intronic
1035360961 7:158314079-158314101 TATCCTGTGCTGAGATGTGGCGG - Intronic
1039252568 8:35682839-35682861 TACCCTGTGCTCAGAGGATGGGG + Intronic
1042411908 8:68475817-68475839 CTCCCTGTGATGTGAGGTAGTGG + Intronic
1043763101 8:84094678-84094700 TACCCTGGGCTTAGAGGCAGTGG - Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046140489 8:110083966-110083988 TCGCCTGTGATGAGAGGTAGAGG + Intergenic
1046297359 8:112238169-112238191 TGTGCTGTGCTGTGAGGTATAGG - Intronic
1047243147 8:123112220-123112242 TAACCTGTGTAGTGAGCTAGTGG - Intronic
1048464773 8:134656221-134656243 GACCCTTTGCTTTGGGGTAGAGG - Intronic
1049199026 8:141330966-141330988 CAGCCTGTGGTGTGAGCTAGAGG + Intergenic
1049251442 8:141591225-141591247 GGCCCTGTGCTGTGTGGAAGTGG + Intergenic
1049596358 8:143485516-143485538 TTACCTGTGGTCTGAGGTAGGGG - Intronic
1050726211 9:8652100-8652122 TACCCTGAGCTGTAAATTAGAGG - Intronic
1055564686 9:77556590-77556612 TGGCCTGGGCTGTGAGGAAGAGG - Intronic
1055910478 9:81344850-81344872 TGCCCTGTCCTGTGTGGTATGGG - Intergenic
1056851974 9:90092772-90092794 TGCCCTGAGCTGTGAGAAAGGGG + Intergenic
1058225987 9:102364735-102364757 TACCCTGGGCTATGAGGGAAAGG + Intergenic
1062048882 9:134437197-134437219 TGCCCTGTGCTCTGAGTGAGGGG + Intronic
1188022449 X:25173725-25173747 TTCACTGTGATGTGGGGTAGGGG + Intergenic
1195345267 X:103944100-103944122 TGCCCAGTGATGTCAGGTAGAGG - Intronic
1198227378 X:134657960-134657982 TACCCTGTGCAGTTGGGGAGTGG + Intronic
1201144247 Y:11054395-11054417 TCCCCTGAGCTGGGAGGTTGAGG + Intergenic
1201896245 Y:18995691-18995713 AAGCCTCTGCTGTGAGGTCGAGG + Intergenic