ID: 910169989

View in Genome Browser
Species Human (GRCh38)
Location 1:84367482-84367504
Sequence TGAAAGGCCCAGAATTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910169981_910169989 29 Left 910169981 1:84367430-84367452 CCAACCTTCTATAATCACTCATC 0: 1
1: 0
2: 2
3: 9
4: 160
Right 910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG No data
910169982_910169989 25 Left 910169982 1:84367434-84367456 CCTTCTATAATCACTCATCCACT 0: 1
1: 0
2: 0
3: 10
4: 184
Right 910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG No data
910169987_910169989 -9 Left 910169987 1:84367468-84367490 CCAACCTCAGGCATTGAAAGGCC 0: 1
1: 0
2: 0
3: 14
4: 156
Right 910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG No data
910169984_910169989 7 Left 910169984 1:84367452-84367474 CCACTTCGAAGGCACTCCAACCT No data
Right 910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910169989 Original CRISPR TGAAAGGCCCAGAATTGAAG AGG Intronic
No off target data available for this crispr