ID: 910177157

View in Genome Browser
Species Human (GRCh38)
Location 1:84443089-84443111
Sequence CCCTTGGGGCCTATGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910177150_910177157 -6 Left 910177150 1:84443072-84443094 CCACAGACCAGGAGATCCCCTTG No data
Right 910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG No data
910177149_910177157 -5 Left 910177149 1:84443071-84443093 CCCACAGACCAGGAGATCCCCTT No data
Right 910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG No data
910177144_910177157 28 Left 910177144 1:84443038-84443060 CCAGTTAGTATTATTTTCCCATG No data
Right 910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG No data
910177146_910177157 11 Left 910177146 1:84443055-84443077 CCCATGGTCTTCACAACCCACAG 0: 79
1: 156
2: 296
3: 378
4: 602
Right 910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG No data
910177143_910177157 29 Left 910177143 1:84443037-84443059 CCCAGTTAGTATTATTTTCCCAT No data
Right 910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG No data
910177147_910177157 10 Left 910177147 1:84443056-84443078 CCATGGTCTTCACAACCCACAGA 0: 83
1: 160
2: 296
3: 412
4: 679
Right 910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910177157 Original CRISPR CCCTTGGGGCCTATGCCACC AGG Intergenic
No off target data available for this crispr